ID: 971170908

View in Genome Browser
Species Human (GRCh38)
Location 4:24231545-24231567
Sequence GGACTTTACCCAGGCAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170901_971170908 16 Left 971170901 4:24231506-24231528 CCAAGCCCAGAAATCTTAGGAGA No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170898_971170908 25 Left 971170898 4:24231497-24231519 CCAAAGGACCCAAGCCCAGAAAT No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170900_971170908 17 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170897_971170908 26 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170904_971170908 10 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170903_971170908 11 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170908 Original CRISPR GGACTTTACCCAGGCAACAA AGG Intergenic