ID: 971170913

View in Genome Browser
Species Human (GRCh38)
Location 4:24231557-24231579
Sequence GGCAACAAAGGTTTCCGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170901_971170913 28 Left 971170901 4:24231506-24231528 CCAAGCCCAGAAATCTTAGGAGA No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data
971170904_971170913 22 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data
971170900_971170913 29 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data
971170903_971170913 23 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170913 Original CRISPR GGCAACAAAGGTTTCCGGAA GGG Intergenic