ID: 971174173

View in Genome Browser
Species Human (GRCh38)
Location 4:24264823-24264845
Sequence CTGTTGTTTTTGTGGCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971174170_971174173 -9 Left 971174170 4:24264809-24264831 CCTATTTGTTTCCTCTGTTGTTT No data
Right 971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG No data
971174169_971174173 20 Left 971174169 4:24264780-24264802 CCAGAGCAGGTGTACAAGAACTG No data
Right 971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG No data
971174168_971174173 21 Left 971174168 4:24264779-24264801 CCCAGAGCAGGTGTACAAGAACT No data
Right 971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG No data
971174167_971174173 28 Left 971174167 4:24264772-24264794 CCATGCACCCAGAGCAGGTGTAC No data
Right 971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971174173 Original CRISPR CTGTTGTTTTTGTGGCCAAA TGG Intergenic
No off target data available for this crispr