ID: 971174324

View in Genome Browser
Species Human (GRCh38)
Location 4:24266248-24266270
Sequence AACTCCATCTGGTCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971174324_971174329 -2 Left 971174324 4:24266248-24266270 CCCACTTGGGACCAGATGGAGTT No data
Right 971174329 4:24266269-24266291 TTGGGTGAGCCTTGACCCTAAGG No data
971174324_971174331 11 Left 971174324 4:24266248-24266270 CCCACTTGGGACCAGATGGAGTT No data
Right 971174331 4:24266282-24266304 GACCCTAAGGTGTGCCGCTGAGG No data
971174324_971174335 30 Left 971174324 4:24266248-24266270 CCCACTTGGGACCAGATGGAGTT No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971174324 Original CRISPR AACTCCATCTGGTCCCAAGT GGG (reversed) Intergenic