ID: 971174325

View in Genome Browser
Species Human (GRCh38)
Location 4:24266249-24266271
Sequence CAACTCCATCTGGTCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971174325_971174329 -3 Left 971174325 4:24266249-24266271 CCACTTGGGACCAGATGGAGTTG No data
Right 971174329 4:24266269-24266291 TTGGGTGAGCCTTGACCCTAAGG No data
971174325_971174335 29 Left 971174325 4:24266249-24266271 CCACTTGGGACCAGATGGAGTTG No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174325_971174331 10 Left 971174325 4:24266249-24266271 CCACTTGGGACCAGATGGAGTTG No data
Right 971174331 4:24266282-24266304 GACCCTAAGGTGTGCCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971174325 Original CRISPR CAACTCCATCTGGTCCCAAG TGG (reversed) Intergenic