ID: 971174328

View in Genome Browser
Species Human (GRCh38)
Location 4:24266259-24266281
Sequence AAGGCTCACCCAACTCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971174328_971174336 22 Left 971174328 4:24266259-24266281 CCAGATGGAGTTGGGTGAGCCTT No data
Right 971174336 4:24266304-24266326 GAGTTGCTTCGTGTTGTAGGAGG No data
971174328_971174331 0 Left 971174328 4:24266259-24266281 CCAGATGGAGTTGGGTGAGCCTT No data
Right 971174331 4:24266282-24266304 GACCCTAAGGTGTGCCGCTGAGG No data
971174328_971174335 19 Left 971174328 4:24266259-24266281 CCAGATGGAGTTGGGTGAGCCTT No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971174328 Original CRISPR AAGGCTCACCCAACTCCATC TGG (reversed) Intergenic