ID: 971174332

View in Genome Browser
Species Human (GRCh38)
Location 4:24266284-24266306
Sequence CTCCTCAGCGGCACACCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971174332_971174335 -6 Left 971174332 4:24266284-24266306 CCCTAAGGTGTGCCGCTGAGGAG No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174332_971174336 -3 Left 971174332 4:24266284-24266306 CCCTAAGGTGTGCCGCTGAGGAG No data
Right 971174336 4:24266304-24266326 GAGTTGCTTCGTGTTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971174332 Original CRISPR CTCCTCAGCGGCACACCTTA GGG (reversed) Intergenic