ID: 971174335

View in Genome Browser
Species Human (GRCh38)
Location 4:24266301-24266323
Sequence GAGGAGTTGCTTCGTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971174332_971174335 -6 Left 971174332 4:24266284-24266306 CCCTAAGGTGTGCCGCTGAGGAG No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174324_971174335 30 Left 971174324 4:24266248-24266270 CCCACTTGGGACCAGATGGAGTT No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174333_971174335 -7 Left 971174333 4:24266285-24266307 CCTAAGGTGTGCCGCTGAGGAGT No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174330_971174335 0 Left 971174330 4:24266278-24266300 CCTTGACCCTAAGGTGTGCCGCT No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174328_971174335 19 Left 971174328 4:24266259-24266281 CCAGATGGAGTTGGGTGAGCCTT No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data
971174325_971174335 29 Left 971174325 4:24266249-24266271 CCACTTGGGACCAGATGGAGTTG No data
Right 971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971174335 Original CRISPR GAGGAGTTGCTTCGTGTTGT AGG Intergenic