ID: 971177538

View in Genome Browser
Species Human (GRCh38)
Location 4:24294106-24294128
Sequence GCTTTGGTATGAGCTCGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971177538_971177543 9 Left 971177538 4:24294106-24294128 CCAAGTCGAGCTCATACCAAAGC No data
Right 971177543 4:24294138-24294160 TGGTCAGCCTGAACACACTCAGG No data
971177538_971177545 20 Left 971177538 4:24294106-24294128 CCAAGTCGAGCTCATACCAAAGC No data
Right 971177545 4:24294149-24294171 AACACACTCAGGCTGAACTCAGG No data
971177538_971177546 21 Left 971177538 4:24294106-24294128 CCAAGTCGAGCTCATACCAAAGC No data
Right 971177546 4:24294150-24294172 ACACACTCAGGCTGAACTCAGGG No data
971177538_971177547 22 Left 971177538 4:24294106-24294128 CCAAGTCGAGCTCATACCAAAGC No data
Right 971177547 4:24294151-24294173 CACACTCAGGCTGAACTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971177538 Original CRISPR GCTTTGGTATGAGCTCGACT TGG (reversed) Intergenic
No off target data available for this crispr