ID: 971178058

View in Genome Browser
Species Human (GRCh38)
Location 4:24300590-24300612
Sequence CTCTGTCACATATAAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971178058_971178059 1 Left 971178058 4:24300590-24300612 CCATCAGTTTATATGTGACAGAG No data
Right 971178059 4:24300614-24300636 ACATCTACCTAGTATTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971178058 Original CRISPR CTCTGTCACATATAAACTGA TGG (reversed) Intergenic
No off target data available for this crispr