ID: 971178132

View in Genome Browser
Species Human (GRCh38)
Location 4:24301402-24301424
Sequence TGCAAATAGCCCTATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971178127_971178132 -3 Left 971178127 4:24301382-24301404 CCCTAAAATTTGTGGCAAATTGC No data
Right 971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG No data
971178125_971178132 5 Left 971178125 4:24301374-24301396 CCTTTCATCCCTAAAATTTGTGG No data
Right 971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG No data
971178128_971178132 -4 Left 971178128 4:24301383-24301405 CCTAAAATTTGTGGCAAATTGCA No data
Right 971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG No data
971178124_971178132 22 Left 971178124 4:24301357-24301379 CCAGTAGTGATTTACAGCCTTTC No data
Right 971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971178132 Original CRISPR TGCAAATAGCCCTATGGGGT AGG Intergenic
No off target data available for this crispr