ID: 971180275

View in Genome Browser
Species Human (GRCh38)
Location 4:24323767-24323789
Sequence CAGAGCAAAGAGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971180275_971180278 4 Left 971180275 4:24323767-24323789 CCATCCTCCTGCTCTTTGCTCTG No data
Right 971180278 4:24323794-24323816 AAAGATCCACCTACGACCTCAGG 0: 290
1: 334
2: 165
3: 83
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971180275 Original CRISPR CAGAGCAAAGAGCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr