ID: 971182017

View in Genome Browser
Species Human (GRCh38)
Location 4:24337546-24337568
Sequence TCATCTCCCCACGCTCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971182017_971182019 -4 Left 971182017 4:24337546-24337568 CCCTACTGAGCGTGGGGAGATGA No data
Right 971182019 4:24337565-24337587 ATGATGTCTGACCAGTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971182017 Original CRISPR TCATCTCCCCACGCTCAGTA GGG (reversed) Intergenic
No off target data available for this crispr