ID: 971188786

View in Genome Browser
Species Human (GRCh38)
Location 4:24406931-24406953
Sequence AAGAGGATACTGATCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971188786_971188793 22 Left 971188786 4:24406931-24406953 CCCTCAGGGATCAGTATCCTCTT No data
Right 971188793 4:24406976-24406998 CCTTTCTCTGTGCTCTTCTTGGG No data
971188786_971188790 -3 Left 971188786 4:24406931-24406953 CCCTCAGGGATCAGTATCCTCTT No data
Right 971188790 4:24406951-24406973 CTTGCTGCTCATTCTCAGGCAGG No data
971188786_971188788 -7 Left 971188786 4:24406931-24406953 CCCTCAGGGATCAGTATCCTCTT No data
Right 971188788 4:24406947-24406969 TCCTCTTGCTGCTCATTCTCAGG No data
971188786_971188791 21 Left 971188786 4:24406931-24406953 CCCTCAGGGATCAGTATCCTCTT No data
Right 971188791 4:24406975-24406997 ACCTTTCTCTGTGCTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971188786 Original CRISPR AAGAGGATACTGATCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr