ID: 971189504

View in Genome Browser
Species Human (GRCh38)
Location 4:24413886-24413908
Sequence GATTAAAGACATTTAACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971189504_971189511 26 Left 971189504 4:24413886-24413908 CCATATGTTAAATGTCTTTAATC No data
Right 971189511 4:24413935-24413957 ATACTACCGGGATTTTGAAAAGG No data
971189504_971189510 14 Left 971189504 4:24413886-24413908 CCATATGTTAAATGTCTTTAATC No data
Right 971189510 4:24413923-24413945 TTGAGTCAAGAAATACTACCGGG No data
971189504_971189509 13 Left 971189504 4:24413886-24413908 CCATATGTTAAATGTCTTTAATC No data
Right 971189509 4:24413922-24413944 CTTGAGTCAAGAAATACTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971189504 Original CRISPR GATTAAAGACATTTAACATA TGG (reversed) Intergenic
No off target data available for this crispr