ID: 971189772

View in Genome Browser
Species Human (GRCh38)
Location 4:24416397-24416419
Sequence GAGGCACGGGACCATGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971189764_971189772 15 Left 971189764 4:24416359-24416381 CCAAGCCTGTGCAAAATGAATTT No data
Right 971189772 4:24416397-24416419 GAGGCACGGGACCATGTGAGAGG No data
971189769_971189772 -9 Left 971189769 4:24416383-24416405 CCAGGGAGAAAAGAGAGGCACGG No data
Right 971189772 4:24416397-24416419 GAGGCACGGGACCATGTGAGAGG No data
971189765_971189772 10 Left 971189765 4:24416364-24416386 CCTGTGCAAAATGAATTTGCCAG No data
Right 971189772 4:24416397-24416419 GAGGCACGGGACCATGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971189772 Original CRISPR GAGGCACGGGACCATGTGAG AGG Intergenic
No off target data available for this crispr