ID: 971196073

View in Genome Browser
Species Human (GRCh38)
Location 4:24472309-24472331
Sequence GTACCAAGTGAGCGCGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971196065_971196073 0 Left 971196065 4:24472286-24472308 CCGAGCCTCTGCCTCCCCACCAA No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196051_971196073 23 Left 971196051 4:24472263-24472285 CCCCCCATCCTCCCCACCCCCTC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196056_971196073 15 Left 971196056 4:24472271-24472293 CCTCCCCACCCCCTCCCGAGCCT No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196058_971196073 11 Left 971196058 4:24472275-24472297 CCCACCCCCTCCCGAGCCTCTGC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196055_971196073 19 Left 971196055 4:24472267-24472289 CCATCCTCCCCACCCCCTCCCGA No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196061_971196073 6 Left 971196061 4:24472280-24472302 CCCCTCCCGAGCCTCTGCCTCCC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196064_971196073 1 Left 971196064 4:24472285-24472307 CCCGAGCCTCTGCCTCCCCACCA No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196059_971196073 10 Left 971196059 4:24472276-24472298 CCACCCCCTCCCGAGCCTCTGCC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196066_971196073 -5 Left 971196066 4:24472291-24472313 CCTCTGCCTCCCCACCAAGTACC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196053_971196073 21 Left 971196053 4:24472265-24472287 CCCCATCCTCCCCACCCCCTCCC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196063_971196073 4 Left 971196063 4:24472282-24472304 CCTCCCGAGCCTCTGCCTCCCCA No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196060_971196073 7 Left 971196060 4:24472279-24472301 CCCCCTCCCGAGCCTCTGCCTCC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196052_971196073 22 Left 971196052 4:24472264-24472286 CCCCCATCCTCCCCACCCCCTCC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196062_971196073 5 Left 971196062 4:24472281-24472303 CCCTCCCGAGCCTCTGCCTCCCC No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196057_971196073 12 Left 971196057 4:24472274-24472296 CCCCACCCCCTCCCGAGCCTCTG No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data
971196054_971196073 20 Left 971196054 4:24472266-24472288 CCCATCCTCCCCACCCCCTCCCG No data
Right 971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971196073 Original CRISPR GTACCAAGTGAGCGCGCGGC AGG Intergenic
No off target data available for this crispr