ID: 971196221

View in Genome Browser
Species Human (GRCh38)
Location 4:24473126-24473148
Sequence AGGAGGTCGGAGAAGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971196221_971196234 13 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196234 4:24473162-24473184 GGGCCATGCGCGTCCCGGGACGG No data
971196221_971196236 17 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196236 4:24473166-24473188 CATGCGCGTCCCGGGACGGCAGG No data
971196221_971196238 19 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196238 4:24473168-24473190 TGCGCGTCCCGGGACGGCAGGGG No data
971196221_971196232 9 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196232 4:24473158-24473180 CGCCGGGCCATGCGCGTCCCGGG No data
971196221_971196225 -8 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196225 4:24473141-24473163 GACCTCCTCGCCATAGCCGCCGG No data
971196221_971196240 25 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196240 4:24473174-24473196 TCCCGGGACGGCAGGGGGCGCGG No data
971196221_971196239 20 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196239 4:24473169-24473191 GCGCGTCCCGGGACGGCAGGGGG No data
971196221_971196226 -7 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196226 4:24473142-24473164 ACCTCCTCGCCATAGCCGCCGGG No data
971196221_971196237 18 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196237 4:24473167-24473189 ATGCGCGTCCCGGGACGGCAGGG No data
971196221_971196231 8 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196231 4:24473157-24473179 CCGCCGGGCCATGCGCGTCCCGG No data
971196221_971196242 26 Left 971196221 4:24473126-24473148 CCGGCCGCCTTCTCCGACCTCCT No data
Right 971196242 4:24473175-24473197 CCCGGGACGGCAGGGGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971196221 Original CRISPR AGGAGGTCGGAGAAGGCGGC CGG (reversed) Intergenic
No off target data available for this crispr