ID: 971196299

View in Genome Browser
Species Human (GRCh38)
Location 4:24473464-24473486
Sequence GCGTGGACACGCGCGCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971196299_971196307 -6 Left 971196299 4:24473464-24473486 CCCCCCCGCGCGCGTGTCCACGC No data
Right 971196307 4:24473481-24473503 CCACGCAGGCACAGACACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971196299 Original CRISPR GCGTGGACACGCGCGCGGGG GGG (reversed) Intergenic
No off target data available for this crispr