ID: 971197194

View in Genome Browser
Species Human (GRCh38)
Location 4:24480833-24480855
Sequence CAGAAGATCAAGAAGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971197190_971197194 19 Left 971197190 4:24480791-24480813 CCATTTGAAGACAGATGATGGCA No data
Right 971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971197194 Original CRISPR CAGAAGATCAAGAAGAAGTC TGG Intergenic
No off target data available for this crispr