ID: 971198020

View in Genome Browser
Species Human (GRCh38)
Location 4:24487702-24487724
Sequence TCCCTTGATTCTCCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971198016_971198020 13 Left 971198016 4:24487666-24487688 CCAATTTGCACCTACCTGACATA No data
Right 971198020 4:24487702-24487724 TCCCTTGATTCTCCAAAGGCAGG No data
971198017_971198020 3 Left 971198017 4:24487676-24487698 CCTACCTGACATAGTTTATATTA No data
Right 971198020 4:24487702-24487724 TCCCTTGATTCTCCAAAGGCAGG No data
971198018_971198020 -1 Left 971198018 4:24487680-24487702 CCTGACATAGTTTATATTACAAT No data
Right 971198020 4:24487702-24487724 TCCCTTGATTCTCCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971198020 Original CRISPR TCCCTTGATTCTCCAAAGGC AGG Intergenic
No off target data available for this crispr