ID: 971198097

View in Genome Browser
Species Human (GRCh38)
Location 4:24488456-24488478
Sequence CTTGAATCACAGACAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971198093_971198097 21 Left 971198093 4:24488412-24488434 CCTACTGCCTCCTCTTTGCAAGA No data
Right 971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG No data
971198095_971198097 11 Left 971198095 4:24488422-24488444 CCTCTTTGCAAGACACTTACATG No data
Right 971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG No data
971198094_971198097 14 Left 971198094 4:24488419-24488441 CCTCCTCTTTGCAAGACACTTAC No data
Right 971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971198097 Original CRISPR CTTGAATCACAGACAGAACA AGG Intergenic
No off target data available for this crispr