ID: 971200156

View in Genome Browser
Species Human (GRCh38)
Location 4:24503343-24503365
Sequence CGTCCCGCACAGATGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971200156_971200162 9 Left 971200156 4:24503343-24503365 CCGTGTCCCATCTGTGCGGGACG No data
Right 971200162 4:24503375-24503397 ATTGGACTGTTCAACTCACCTGG 0: 80
1: 374
2: 270
3: 81
4: 104
971200156_971200160 -9 Left 971200156 4:24503343-24503365 CCGTGTCCCATCTGTGCGGGACG No data
Right 971200160 4:24503357-24503379 TGCGGGACGCCACTGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971200156 Original CRISPR CGTCCCGCACAGATGGGACA CGG (reversed) Intergenic
No off target data available for this crispr