ID: 971201110

View in Genome Browser
Species Human (GRCh38)
Location 4:24509854-24509876
Sequence AAATGTTAACAGTTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971201102_971201110 26 Left 971201102 4:24509805-24509827 CCACTAAAAAAAAAAAAAATGCG No data
Right 971201110 4:24509854-24509876 AAATGTTAACAGTTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971201110 Original CRISPR AAATGTTAACAGTTGATGCA GGG Intergenic
No off target data available for this crispr