ID: 971203725

View in Genome Browser
Species Human (GRCh38)
Location 4:24540236-24540258
Sequence CTGGCTGCTTTAAATGATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971203725_971203732 25 Left 971203725 4:24540236-24540258 CCATCATCATTTAAAGCAGCCAG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 971203732 4:24540284-24540306 ATCAGAGTTTCAGGAGCTAGTGG 0: 1
1: 0
2: 1
3: 13
4: 176
971203725_971203728 -4 Left 971203725 4:24540236-24540258 CCATCATCATTTAAAGCAGCCAG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 971203728 4:24540255-24540277 CCAGGTAATTCAAAAGTTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 187
971203725_971203729 -3 Left 971203725 4:24540236-24540258 CCATCATCATTTAAAGCAGCCAG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 971203729 4:24540256-24540278 CAGGTAATTCAAAAGTTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 200
971203725_971203731 16 Left 971203725 4:24540236-24540258 CCATCATCATTTAAAGCAGCCAG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 971203731 4:24540275-24540297 AGGGCTCTCATCAGAGTTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971203725 Original CRISPR CTGGCTGCTTTAAATGATGA TGG (reversed) Exonic
900320243 1:2079951-2079973 CTGGCTGCTTTGGGTGAGGAAGG + Intronic
902091809 1:13909677-13909699 TTGGCTGCTTCTTATGATGAAGG + Intergenic
907580099 1:55564327-55564349 CTGGCTGCATAAAATGATTTAGG + Intergenic
908271455 1:62426585-62426607 CTGGCTGCTTTAGAGGAAAAAGG - Intergenic
908375384 1:63532715-63532737 TTGGCTGATGTAAATGCTGATGG + Exonic
909741833 1:79038550-79038572 ATGGCTGCATTAAATGATACAGG - Intergenic
910541189 1:88359758-88359780 CTTGATGCTTTAAGTGATGATGG + Intergenic
910670934 1:89772039-89772061 GTGGCAGCTTTAAAATATGATGG - Intronic
910809838 1:91224996-91225018 CAGGCTGTTTGAAATTATGAAGG - Intergenic
911681523 1:100721704-100721726 CCGGCTGCTTTCAATTATGCTGG + Intronic
918007269 1:180553592-180553614 CTGGCTGCTTTGGTTCATGAAGG - Intergenic
918064736 1:181092098-181092120 CTGACTGCTTAAACTGAAGAAGG + Intergenic
918821766 1:189265955-189265977 CTGGCTTCTTTAAACTGTGAGGG + Intergenic
919211191 1:194489203-194489225 CTGGCTGCGATAATTTATGATGG + Intergenic
919958701 1:202444093-202444115 CTTGCTCTTTTAAATGGTGATGG - Intronic
921282374 1:213579504-213579526 CTAGCTGAGATAAATGATGAAGG + Intergenic
922470463 1:225873880-225873902 CTGGTTGCTTTAGATACTGAGGG - Intronic
923005608 1:230047108-230047130 CTGGCTGCTTCCACTCATGATGG + Intergenic
923680069 1:236111894-236111916 CTGGCTGTTTTCAATGTTGATGG - Intergenic
924602758 1:245505899-245505921 CTGGTGTCTTTAAATGATTAAGG + Intronic
924646606 1:245883643-245883665 AAGGCTGCTTTAAACCATGAAGG - Intronic
1065403701 10:25337566-25337588 TTGGCTACTATAAATGATGCAGG + Intronic
1068871026 10:61944925-61944947 CTGGCTGAATTTAATGATGGGGG + Intronic
1071915036 10:90285048-90285070 ATGGCTGCTTGAATTCATGAAGG - Intergenic
1071957841 10:90778655-90778677 GTGGCTCCTTTAAATGAAGTGGG + Intronic
1074197880 10:111205310-111205332 CTGGCTGCTTCCACTCATGATGG - Intergenic
1076088335 10:127656253-127656275 CTGGGTGATTAAAATGAAGAAGG - Intergenic
1076832567 10:133003845-133003867 CTGGCTGCTTTTACTGGAGAAGG - Intergenic
1077504918 11:2925534-2925556 CAGGTTGCTTTAAAAGATCAGGG + Intergenic
1080181266 11:29429218-29429240 CTCCCTGCATTAACTGATGAGGG + Intergenic
1080988500 11:37501458-37501480 ATGGGTTCTTTAAATGATAATGG - Intergenic
1081024168 11:37988113-37988135 CAGGCTGTTTTAACTCATGACGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083257410 11:61505278-61505300 CTGGCTGCTGAATAAGATGATGG - Intergenic
1083872344 11:65496858-65496880 TTGGCTCCTGTAAATGATGCAGG - Intergenic
1084724347 11:70931089-70931111 CTGGCTGCTTTCACTGAGCATGG - Intronic
1085913697 11:80859057-80859079 GTGGCTTCCTTAAATGATTAAGG - Intergenic
1090065422 11:123499204-123499226 CTGGTGGCTTTAAAAGAAGAGGG + Intergenic
1090178179 11:124670616-124670638 CTGGAAGCTACAAATGATGAGGG + Intronic
1092913624 12:13170112-13170134 TTAACTGCTTTAAATTATGAAGG + Intergenic
1094034755 12:26056319-26056341 TTAGTTGCCTTAAATGATGAGGG + Intronic
1095710338 12:45281552-45281574 CTGGCTGTTTTAAAAGAGTATGG - Intronic
1096532699 12:52251873-52251895 GTGGCTGCTTTACATGACAACGG + Intronic
1097839948 12:64312023-64312045 CTGGATGCTGGAAATGGTGAAGG + Intronic
1098547891 12:71731587-71731609 CGTGGTCCTTTAAATGATGAAGG + Intergenic
1099042250 12:77670425-77670447 CTGGCTTCATAAAATGATGTAGG - Intergenic
1099075680 12:78104411-78104433 TTGCCTGCTTTTTATGATGAGGG - Intronic
1106842096 13:33694647-33694669 CTGGAGTCTATAAATGATGATGG - Intergenic
1107011568 13:35675735-35675757 GTGCCTGTTTTAACTGATGAGGG - Intergenic
1107894046 13:44941399-44941421 CTGTCTTCTTTATATGGTGAGGG - Intronic
1107900962 13:45013241-45013263 CAGGCTGCTTGGTATGATGAAGG - Intronic
1108522830 13:51260563-51260585 CTGGCTGGTAGAAATGCTGAGGG - Intronic
1108664773 13:52618580-52618602 CTGGCTGCTTTGGAGGATTATGG + Intergenic
1110772263 13:79363188-79363210 CTTACTGCTTTAAATTTTGAGGG - Intronic
1110816441 13:79865618-79865640 TTGGCTGCTTAGAATGAAGAGGG + Intergenic
1111315163 13:86546822-86546844 CTGGCTGTTTCAAATGAGAATGG - Intergenic
1111349059 13:87001954-87001976 CTGTCTGATTTATATGATCATGG - Intergenic
1111673765 13:91361398-91361420 GTGCCTTCTTAAAATGATGATGG + Intergenic
1112556436 13:100472643-100472665 GTGGCTGGTTTGAATAATGATGG + Intronic
1112765766 13:102741300-102741322 CTGCCTGTTTTAAGTGAAGAGGG + Exonic
1113495535 13:110725528-110725550 ATGGCTGCTTTTCCTGATGAAGG + Intergenic
1116478682 14:45371122-45371144 CTGACTGTTTAATATGATGATGG + Intergenic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1118084895 14:62403534-62403556 CTGGCTAATTTAAATAATGCAGG + Intergenic
1119114654 14:72008325-72008347 AAGGCTGATTTAGATGATGAGGG + Intronic
1120259264 14:82161214-82161236 CAGGCTGTTTTAAATGCTGCAGG + Intergenic
1121397470 14:93638950-93638972 CTGTCTGCTTTTATAGATGACGG + Intronic
1123753288 15:23374872-23374894 ATGGATGATGTAAATGATGATGG - Intergenic
1124446365 15:29737340-29737362 CTGGCTGGTGGAAATGATGTTGG - Exonic
1125347973 15:38739130-38739152 CTAGCTGCTTTTAATCATCAGGG + Intergenic
1125444866 15:39743708-39743730 CTGGCCACTTTAAATGAAAATGG - Intronic
1127051585 15:55089515-55089537 CAGGCAGCTGTAAAAGATGAGGG + Intergenic
1129272717 15:74427937-74427959 CTGGCTGCCCTCCATGATGAGGG + Intronic
1132025082 15:98398537-98398559 CAGCATGCTTTATATGATGATGG - Intergenic
1133966278 16:10534198-10534220 CTGACTGCTTTAAATATTGTCGG + Intronic
1134249832 16:12566466-12566488 CTGGCTGTGCTGAATGATGATGG + Intronic
1135574324 16:23573649-23573671 GTTGCTGCTTTACCTGATGAGGG + Exonic
1138073787 16:54020538-54020560 CTGACTGCTTGAATAGATGATGG + Intronic
1139370023 16:66461288-66461310 GGCGCTGCTTTAAATTATGAGGG - Intronic
1140235664 16:73156461-73156483 ATGTCTTCTTGAAATGATGACGG - Intergenic
1143875914 17:9990657-9990679 CTTGCTGCTCTCTATGATGAAGG - Intronic
1144801919 17:17935060-17935082 CTGGCTGCTTTCTATGCTGTGGG - Intronic
1147538972 17:41340714-41340736 CTGGCTGCTGTGAAACATGAGGG - Intergenic
1149251306 17:54772830-54772852 CTGGCTGCTTAAAATCCTAAGGG + Intergenic
1150162232 17:62908150-62908172 CTGGCTGCATTCCTTGATGAAGG + Intergenic
1151097254 17:71512374-71512396 CTTGCTATTTTTAATGATGATGG + Intergenic
1151593830 17:75064714-75064736 GTGGCTGCTTTTACTGAGGACGG - Exonic
1153696554 18:7648857-7648879 CTGGCTGAGATAATTGATGAAGG + Intronic
1156071373 18:33214867-33214889 CAGTCTGCTTTAAATAAAGAAGG - Intronic
1156279863 18:35626677-35626699 CTGGCTCCATGAAATCATGAGGG + Intronic
1157177654 18:45465981-45466003 CTGAGTGCTTTAAATAATGCTGG + Intronic
1157536637 18:48463645-48463667 CTAGCTGGTGTACATGATGAAGG - Intergenic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1164668936 19:30062304-30062326 CTGGTTGCTTTGGTTGATGAGGG - Intergenic
1164871688 19:31650771-31650793 CAATATGCTTTAAATGATGAGGG + Intergenic
925623638 2:5819864-5819886 CTGGCTTCTTTTAATGGTGCTGG - Intergenic
925796123 2:7544678-7544700 CTGCCTGTTTTAAAAGATGTAGG + Intergenic
928473237 2:31595690-31595712 CTGGCTTCATAAAATGATGTAGG - Intergenic
928799759 2:35073373-35073395 CAGACTGCTTTACATGATGATGG - Intergenic
933076157 2:77929668-77929690 CTGAGTGCTTTTAATCATGAAGG + Intergenic
934790629 2:97056831-97056853 CTGGCTGCTGAAACTGATGCTGG + Intergenic
934815831 2:97325698-97325720 CTGGCTGCTGAAACTGATGCTGG - Intergenic
934821864 2:97382785-97382807 CTGGCTGCTGAAACTGATGCTGG + Intergenic
935251265 2:101263564-101263586 CTGTGTGCTTTGAATTATGAAGG + Intronic
935415930 2:102818872-102818894 TTGGATTCTTCAAATGATGATGG + Intronic
936166767 2:110127630-110127652 CGGGCTGCTTGAAAGCATGAGGG - Intronic
937331799 2:121035423-121035445 CTGGTTGCTTCACATGAGGAGGG + Intergenic
937642245 2:124226882-124226904 CTGGTGGCTTTATAAGATGAAGG - Intronic
938611711 2:132954419-132954441 ATGACTGCTTTAAAAGATAATGG + Intronic
939098282 2:137862805-137862827 CAGACTGCTTTCAATCATGACGG + Intergenic
941889781 2:170568026-170568048 CTGGCTGCTTTGAAAGCTGAGGG - Intronic
942731836 2:179068898-179068920 CTGGCTAATGTGAATGATGAAGG - Intergenic
943122362 2:183752549-183752571 CTGCCTGTTTTAAATGCTAAAGG + Intergenic
943846995 2:192662763-192662785 CTTCCTGCTCTAAAGGATGATGG - Intergenic
943862888 2:192891395-192891417 CTGGGAGCTTTAAATGACAAAGG + Intergenic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
946415220 2:219536803-219536825 CTGGCTGCTTTAGAGGAGGGAGG + Intronic
947104698 2:226656550-226656572 CTGGCTGCTTTAAATTTTTGAGG - Intergenic
1169713761 20:8592999-8593021 CTGGAAGCTTTAAAAAATGAGGG - Intronic
1175617999 20:60419898-60419920 CTGGGTGTTTTCAGTGATGAAGG + Intergenic
1177952854 21:27560528-27560550 CTGGCGTCTTTATATGAAGAAGG + Intergenic
1180659265 22:17451671-17451693 CTGGCTGCTTCACATCCTGAAGG + Intronic
1181954101 22:26575668-26575690 CCCGCTGCTGTAAATGATGATGG + Intronic
1182204855 22:28613435-28613457 CTGGCTTCATTAAATGAGGTAGG - Intronic
1183918584 22:41144888-41144910 CTGGCTGCTTTAAAAAAAAAAGG + Intronic
1185011623 22:48317766-48317788 CTGGCTTCTCCAAAAGATGAGGG + Intergenic
952385827 3:32840943-32840965 CAGGCTTTTTTAAATGAGGAAGG - Intronic
952755717 3:36864772-36864794 CTGACTTGTTTACATGATGAAGG - Intronic
953388934 3:42523357-42523379 CTGGCTGCCATAGATGGTGAAGG - Intronic
959142909 3:102507267-102507289 CTGCCAGCTTTCAATGATGCTGG - Intergenic
962388805 3:134954596-134954618 CTGGCTGGGTCAAATGCTGATGG + Intronic
962409451 3:135128502-135128524 CTGGGTGGTTAAAATGATGATGG - Intronic
965857358 3:173104494-173104516 CAGGTTGCTTTTAATCATGATGG + Intronic
969323953 4:6430167-6430189 CTGGCTGCTTTCAGTGATCTTGG - Intronic
970040487 4:11791942-11791964 CAGGCTGCTTCAAATCATGGTGG + Intergenic
970305637 4:14729079-14729101 CTGCCTGCTTTTAATCTTGATGG - Intergenic
971203725 4:24540236-24540258 CTGGCTGCTTTAAATGATGATGG - Exonic
973144440 4:46806948-46806970 TTGGCTGCTGTAAATAATGCTGG + Intronic
973698628 4:53515208-53515230 CTGGCGGCCTTAAGTGATGTGGG - Intronic
974125192 4:57687621-57687643 CAGGCTGCTTCCAATCATGATGG + Intergenic
974972136 4:68843643-68843665 CTGACTGCTCTAATTGTTGAGGG - Intergenic
975237430 4:72015715-72015737 CTTTCTACTTTAAAGGATGAGGG - Intergenic
979818858 4:125145828-125145850 TTGTCTGCATTAAATGCTGAAGG - Intergenic
981173528 4:141653152-141653174 TTGGCTGATTTTTATGATGAAGG + Intronic
987982356 5:25102543-25102565 CTAGCTGAGCTAAATGATGAAGG - Intergenic
988137719 5:27196584-27196606 ATGCCTACTTAAAATGATGAAGG + Intergenic
988423312 5:31032968-31032990 CTGGCTGCTTCCACTCATGATGG - Intergenic
990494023 5:56328820-56328842 CTTCCTTCTTAAAATGATGAAGG - Intergenic
991358906 5:65799729-65799751 CTGGGTCCTTTAAAGGATGATGG + Intronic
991613311 5:68470346-68470368 CTGGATGATTTAAATGAAGACGG - Intergenic
992356081 5:75985096-75985118 CCGGCTGCTTCAACTCATGAAGG + Intergenic
994569998 5:101503917-101503939 CTGGCAGCTTAAAATCATGATGG - Intergenic
996427200 5:123327126-123327148 CTGACTGCATAAAATGATGTAGG + Intergenic
1002842292 6:916467-916489 CTGGCTGACTTAAGTAATGAAGG - Intergenic
1003062250 6:2873022-2873044 ATGGCTCCTTTAAAAGATGATGG + Intergenic
1003338382 6:5196323-5196345 CTACCTGCTTTAACAGATGATGG + Intronic
1008165057 6:48126904-48126926 TTGGCTGCTTTATAAAATGAAGG + Intergenic
1008822722 6:55652982-55653004 CTAGTTGCTTTAAATAATTATGG + Intergenic
1009771543 6:68149724-68149746 CTGAATGGTTGAAATGATGATGG - Intergenic
1011856473 6:91699078-91699100 CTAGCTGATGTAATTGATGAAGG - Intergenic
1012402777 6:98857974-98857996 CAGGCAGCTTTTAATCATGATGG + Intergenic
1013800338 6:113934467-113934489 GTTGCTGCTCTAGATGATGATGG + Exonic
1015095818 6:129414674-129414696 CTTGCTGGTGTAAAGGATGAGGG - Intronic
1015545788 6:134359820-134359842 CTGGCTCCTTAAAATGCTCAAGG + Intergenic
1022143778 7:27516399-27516421 TTGCTTGCTGTAAATGATGAAGG - Intergenic
1022351247 7:29567338-29567360 CTGCCTGCTTTTAAGTATGATGG - Intergenic
1024897510 7:54277772-54277794 CTGGCTTCTTTCAATGGTTATGG - Intergenic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1029357077 7:100060104-100060126 ATGGCTGTTTTAAATAATGAAGG + Intronic
1030834964 7:114272384-114272406 CTGGCTTCATCAAATGAGGAAGG + Intronic
1031505271 7:122574525-122574547 CTGGTTGTTTTTAGTGATGATGG - Intronic
1035529053 8:336966-336988 CTGCCTGCTTTAAATGTTGGAGG + Intergenic
1035766313 8:2108597-2108619 GTGGGTTCTTTAAATGGTGAAGG + Intronic
1036528510 8:9557180-9557202 TTGGATGCATTATATGATGATGG + Intronic
1036933798 8:12981304-12981326 CTGGCTACTTCAAATGGTGCTGG + Intronic
1039153679 8:34531403-34531425 CTGGCTGATTTAGTAGATGAGGG + Intergenic
1039190807 8:34971927-34971949 CTGTCTTCTTGAAAAGATGATGG - Intergenic
1039369374 8:36969349-36969371 CTGGCTGCTATAAGTGCTAATGG - Intergenic
1041394874 8:57379826-57379848 CTGGATGCTGGAAATGATCAGGG + Intergenic
1041872477 8:62650404-62650426 CTGCCTGCTTTAACTGATGCTGG - Intronic
1042614467 8:70633240-70633262 CTGGGTTCTTCACATGATGAAGG - Intronic
1043922611 8:86001011-86001033 CTGAATGCTTTAAATGGGGATGG + Intronic
1044354130 8:91201165-91201187 CTGGCTAGTTTATATCATGATGG + Intronic
1045263461 8:100597607-100597629 CAGGCTGCTTTATATGATGGTGG + Intronic
1046450017 8:114376723-114376745 CTGGCTGCATTAAATGAGTTAGG - Intergenic
1048470876 8:134703053-134703075 CTGGCTTCTTACAATGTTGAAGG - Intronic
1051682839 9:19625479-19625501 CTTGCTGTTATAAATGGTGAGGG - Intronic
1052805530 9:33010059-33010081 CTGGCTACTTTAAAGACTGATGG + Intronic
1053741530 9:41144237-41144259 CTGGCTGCTCCAAATGTTCATGG + Intronic
1054346743 9:63973720-63973742 CTGGCTGCTCCAAATGTTCATGG + Intergenic
1054444521 9:65300380-65300402 CTGGCTGCTCCAAATGTTCATGG + Intergenic
1054485751 9:65721118-65721140 CTGGCTGCTCCAAATGTTCATGG - Intronic
1054686814 9:68287064-68287086 CTGGCTGCTCCAAATGTTCATGG - Intronic
1054740544 9:68801762-68801784 GTGGCCACTCTAAATGATGAAGG - Intronic
1055192411 9:73541386-73541408 CAGGCTACTTTCTATGATGAGGG + Intergenic
1055309381 9:74962861-74962883 CTGGCTGCTTTAATTGGTTTTGG - Intergenic
1058225968 9:102364468-102364490 ATTGCTGGTTTAAATGTTGAAGG + Intergenic
1058435672 9:104960949-104960971 CTGGCTGCATAAAAGGATGGAGG + Intergenic
1059324317 9:113494778-113494800 TTGGCAGCTTTTAATAATGATGG - Intronic
1059772785 9:117443590-117443612 CTGTCTGTTTTAAAAGGTGAGGG + Intergenic
1061702499 9:132426624-132426646 GTTGCTGCTTTAGACGATGATGG - Intronic
1062313486 9:135953020-135953042 TTGGCTGCTTGAAAAGAGGAGGG + Intronic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1191695633 X:63986922-63986944 CACACTGCTTTAAATGATAATGG - Intergenic
1192753588 X:74021127-74021149 CTGGCTTCATAAAATGATTAAGG - Intergenic
1193568131 X:83105611-83105633 CTGGCTCCTTAATCTGATGAAGG - Intergenic
1193820091 X:86149974-86149996 CAGGATTCCTTAAATGATGATGG + Intronic
1195425147 X:104720609-104720631 CTGTCTGTATCAAATGATGAAGG + Intronic
1195627412 X:107018628-107018650 CAGGCTGCTTCAACTCATGAAGG + Intergenic
1195974912 X:110516195-110516217 CTGGCTGCTTTCAATTCTGCAGG + Intergenic
1200375204 X:155773050-155773072 CTGGCTGCTTTAACTTACTAAGG - Intronic
1201321711 Y:12706284-12706306 CAAGCTGCTTTAAGTGAGGATGG - Intronic