ID: 971207349

View in Genome Browser
Species Human (GRCh38)
Location 4:24583881-24583903
Sequence CAGCCAGAGGGGCCGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971207349_971207358 -2 Left 971207349 4:24583881-24583903 CCTCCCCACGGCCCCTCTGGCTG 0: 1
1: 1
2: 4
3: 32
4: 431
Right 971207358 4:24583902-24583924 TGGGAAGTGCCTGCTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971207349 Original CRISPR CAGCCAGAGGGGCCGTGGGG AGG (reversed) Intronic
900126428 1:1070825-1070847 CAGCCAGAGGGGCTGGGAGTTGG + Intergenic
900318423 1:2070683-2070705 GAGCCATGGGGGCCGTGGAGGGG + Intronic
900367068 1:2315663-2315685 GAGCCAGGGGGCCCGTGAGGAGG - Intergenic
900386689 1:2413893-2413915 TAGCCAGAGGGCCTGCGGGGCGG - Intergenic
900502807 1:3014892-3014914 CAGCAAGCGGGGCCGGGAGGGGG + Intergenic
900519208 1:3097639-3097661 CCCCCAGAGGGGCTGTGGGGCGG - Intronic
900982122 1:6051763-6051785 CGGGCAGGGGGGCGGTGGGGTGG + Intronic
901000244 1:6145451-6145473 CTGACAGATGGGCCTTGGGGTGG - Intronic
901493968 1:9610821-9610843 CACCCCAAGGGGCCGTGGGAGGG + Intronic
901815519 1:11791323-11791345 CACCCTGAGGGGATGTGGGGTGG + Exonic
902191535 1:14766562-14766584 CACAGAGAGGGGCCTTGGGGAGG + Intronic
902409564 1:16205174-16205196 CAGCTGGGGGAGCCGTGGGGAGG + Exonic
902511975 1:16971617-16971639 CCGCCAGAGGGTGCGTGGGCTGG + Exonic
902638378 1:17750336-17750358 CAGTCAGTGGGCCCCTGGGGTGG + Intergenic
903157830 1:21460179-21460201 CAGCCAGCAGAGCCGTGGTGAGG - Intronic
903650672 1:24919756-24919778 CAGCTAGTGGAACCGTGGGGGGG - Intronic
903693876 1:25193314-25193336 CAGGCAGCGGGGCCGGGGGATGG + Intergenic
904044680 1:27602514-27602536 GAGCCAGAGGGGCAGGGGGCTGG - Intronic
904886025 1:33739082-33739104 CAGCCAGAGAGGCTGGGGAGGGG - Intronic
905091894 1:35436560-35436582 TAGCCAGAGGGGCTTTGGGAAGG - Intronic
905358912 1:37404749-37404771 AAGCCAGAGGGGCCTTGGAGAGG + Intergenic
906292929 1:44631758-44631780 CAGCGGGAGGGGTCGTGGAGTGG + Intronic
906320060 1:44810180-44810202 CAGGCAGAGAGGCAGCGGGGAGG - Intronic
906345614 1:45012643-45012665 CAACCAGAGGGACTGGGGGGAGG - Intronic
906506041 1:46380307-46380329 CTGCTAGAGGGGCTGTGGGCAGG + Intergenic
906638067 1:47423439-47423461 GAGTTAGAGGGGCCCTGGGGTGG + Intergenic
907319558 1:53594062-53594084 CTGCCAGAGGGGCTGGGGTGAGG + Intronic
907722164 1:56982267-56982289 TAGCCAGAGGGATGGTGGGGAGG - Intergenic
907874492 1:58472580-58472602 AAGTCAGTGGGGCTGTGGGGAGG + Intronic
908667707 1:66510712-66510734 CAGCCTCAGTGGCAGTGGGGAGG - Intergenic
910835208 1:91501359-91501381 CAGCCAGCGGGACCGCGTGGGGG - Intronic
911183809 1:94884172-94884194 CAGCCAGGTGGGAGGTGGGGTGG - Intronic
912473747 1:109923257-109923279 CAGCCACAGGGGCCATGGAGGGG - Exonic
912640963 1:111346104-111346126 TATCCCGGGGGGCCGTGGGGAGG - Intergenic
912699830 1:111869087-111869109 CAGTGAGAGGGCCCGTGGGCAGG - Intronic
913122367 1:115753788-115753810 CAGTCAGAGGGAAGGTGGGGAGG + Intronic
915080136 1:153346277-153346299 GAGGCAGAGGGGCAGTGGAGAGG - Intronic
915105739 1:153534220-153534242 TGGCAAGAGGGGCCCTGGGGTGG - Intergenic
915244083 1:154544023-154544045 CATCCATAGCGTCCGTGGGGAGG + Exonic
915280873 1:154821356-154821378 CAGCCTGAAGGGCCGGGGGCTGG + Intronic
915312001 1:155009607-155009629 CAGCGAGAGCGGATGTGGGGTGG - Intronic
915447060 1:155979829-155979851 AAGCCGGAGGGGCAGTGTGGGGG - Intronic
916084254 1:161257222-161257244 CAGCCAAAGGGTCAGTGGGTTGG - Intergenic
916178426 1:162062640-162062662 GAGCCAGAGTGGGGGTGGGGTGG - Intergenic
919559284 1:199097304-199097326 CAGCCAAAGGGTCAGTGGGTTGG - Intergenic
919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG + Intronic
919747574 1:201018053-201018075 CAGCCAGAGGGGCACTGAGAGGG - Intronic
919857116 1:201713524-201713546 CAGAGAGAGGTGCCGTGGGAAGG - Intronic
919939464 1:202276362-202276384 CAGCCAGAGGTGGCGGAGGGAGG - Exonic
920564306 1:206961188-206961210 CAGCTGGAGTGGCTGTGGGGAGG + Exonic
920666287 1:207964853-207964875 CAGCCAGAGGGAATGTGTGGAGG - Intergenic
921171944 1:212558458-212558480 CAGTCGGCGGGGCCGTGGGAGGG - Intergenic
921936969 1:220804485-220804507 CAGCCAGGGGAGCTGTGGGCTGG - Intronic
922464881 1:225839799-225839821 CAGAGAGAGGGGCCGGGGTGAGG - Intronic
924637185 1:245799250-245799272 GAGAGAGAGGGGCCGAGGGGAGG + Intronic
1065314620 10:24451290-24451312 CAGCCTGAAGGGCAGTGGGCAGG - Intronic
1067018320 10:42773748-42773770 AAGCCAGAGGGCCTGTGGGTGGG - Intergenic
1067834284 10:49628581-49628603 CAGGAAGAGGGGGCATGGGGAGG + Intronic
1069705186 10:70455066-70455088 TAGCCTCAGGGGCCCTGGGGTGG + Intergenic
1070171677 10:73937807-73937829 CAGCCAGAGCTGAGGTGGGGTGG + Intergenic
1073423198 10:103440655-103440677 CACCCAGTGGGGCCGAGGGAGGG + Intronic
1073547180 10:104360448-104360470 GAGCAAGAGGGGCGGGGGGGAGG + Intronic
1074311584 10:112327447-112327469 CAGACAGAGGGGCCTGGGGCAGG + Intergenic
1075507473 10:123037125-123037147 CAGCTAGTGGGGCCGTGGCCGGG + Intronic
1075697488 10:124447631-124447653 CAGCCAGGGGCGGCGGGGGGCGG - Exonic
1076413077 10:130265571-130265593 CTGCCAGAGGTGCTGTGGGAGGG + Intergenic
1076423655 10:130351945-130351967 CAGGCAGAGGCTCTGTGGGGCGG - Intergenic
1076529415 10:131134701-131134723 CTTCCAGAGGGGCTGGGGGGTGG + Intronic
1076541146 10:131215660-131215682 CAGAGAGAGGGGCTGTGGAGAGG + Intronic
1076599985 10:131651051-131651073 GAGCCAGAGGGGGCTCGGGGAGG + Intergenic
1076619570 10:131778617-131778639 CAACCAGAGGGGCCCTGCAGTGG + Intergenic
1076702906 10:132283491-132283513 CAGACAGATGGGCAGTGGGGAGG + Intronic
1076793583 10:132788537-132788559 CAGGCAGCGGGGCCGCCGGGCGG - Intergenic
1076990115 11:268326-268348 GAGCCAGGGGGGCCGAGGAGCGG - Intergenic
1077025915 11:439825-439847 CAGCTGGAGGGGCCGGGGGGTGG - Intronic
1077285095 11:1762069-1762091 CAGCCACAGGGTCCATGTGGAGG - Intronic
1077330265 11:1981054-1981076 CAGGCAGAGGGGGTGTGGAGTGG + Intronic
1077815639 11:5683179-5683201 GAGCCCAAGGGGTCGTGGGGAGG - Intronic
1079010069 11:16820755-16820777 CAGCTAGTGGGGCAGTGGGGAGG - Intronic
1079335161 11:19564601-19564623 TAGCGAGAGGGGCTGAGGGGCGG + Intronic
1079592016 11:22192944-22192966 GAGCCAGCCGGGCCGGGGGGCGG + Intergenic
1081652737 11:44835173-44835195 CAGAAAAGGGGGCCGTGGGGAGG + Intronic
1083791548 11:64989321-64989343 CAGCTCGAGGGGCTGTGGAGGGG + Exonic
1084494817 11:69497675-69497697 CAGCCAGAGTGGGGTTGGGGTGG + Intergenic
1084596707 11:70120881-70120903 CAGCCATGGGGGCTGTGGGCTGG - Intronic
1084985782 11:72870018-72870040 CAGCAAGTGGGACAGTGGGGTGG - Intronic
1085237652 11:75027449-75027471 TAGGCAGAGGGGCGGGGGGGTGG - Intergenic
1085716740 11:78879567-78879589 CAGACAGGGCGGCCGTGTGGAGG - Intronic
1089377523 11:118005106-118005128 CAGGTAGAGGGGATGTGGGGAGG - Intergenic
1089611443 11:119671689-119671711 CAGCCACAGGGAGAGTGGGGAGG + Intronic
1090880440 11:130827864-130827886 CAGCCAGACGTGGGGTGGGGTGG + Intergenic
1090972177 11:131653364-131653386 CAGCCGGAGGGCCCTGGGGGAGG + Intronic
1090995195 11:131859942-131859964 CAGACAAAGGGGGAGTGGGGAGG - Intronic
1202813244 11_KI270721v1_random:36233-36255 CAGGCAGAGGGGGTGTGGAGTGG + Intergenic
1091584723 12:1809680-1809702 CAGCCAGCGGGGGCGGGGGGAGG + Intronic
1092918418 12:13208894-13208916 CAGGTAGAGGTGCCGTGGGAGGG + Intronic
1095665051 12:44788269-44788291 CCTTCAGAGGGTCCGTGGGGTGG - Intronic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1096195597 12:49647152-49647174 CACCCAGAGGGCCAGTGGGCTGG - Intronic
1096229059 12:49887485-49887507 CAGTCAGAGGGGCAGGGAGGAGG + Intronic
1096585143 12:52615036-52615058 CAGCCAGAGGGGACATGAGTTGG + Intronic
1096789068 12:54034040-54034062 CAGCCGGAGGGGCTGAGGGGGGG - Intronic
1096829701 12:54304569-54304591 CAGCCACAGGGGGCAAGGGGAGG + Intronic
1097109309 12:56646356-56646378 CAGCCATAGGGGCGGTGGTTAGG + Intergenic
1099246383 12:80197786-80197808 CATCCAGAGGGACTGTGGGAAGG - Intergenic
1100142296 12:91633922-91633944 CAGCCTGAGGGGAAGTGCGGAGG + Intergenic
1100614441 12:96220185-96220207 CAGGCAGAGGAGCAGTGGTGGGG - Intronic
1100685516 12:96983048-96983070 GAGTCAGAGGCACCGTGGGGTGG + Intergenic
1100871880 12:98918172-98918194 GGGCCTGAGGGGCCATGGGGAGG - Intronic
1101452248 12:104790219-104790241 CAGCAAAAGGGCCGGTGGGGAGG - Intergenic
1101735492 12:107459937-107459959 CAGCCAGGGGGGCAGGGGTGGGG + Intronic
1103951532 12:124554202-124554224 CTGCCAGAGGTGCCGCGAGGTGG + Intronic
1104492595 12:129208039-129208061 CAGCCTGAGGGGCCGAGCAGAGG + Intronic
1104928061 12:132323929-132323951 CAGCCGGAGTGGCCGTGGCCGGG - Intronic
1105414257 13:20194632-20194654 GAGCCAGAGGTGACTTGGGGTGG + Intergenic
1105514230 13:21076116-21076138 GGGCCGGAGGGGTCGTGGGGGGG - Intergenic
1106552374 13:30783446-30783468 GAGACAGAGGAGCAGTGGGGAGG - Intergenic
1107072544 13:36286701-36286723 CAGCCAGAGGGAGCGAAGGGTGG - Intronic
1108149800 13:47521497-47521519 CAGCCAAAGGGTCAGTGGGTTGG + Intergenic
1112581306 13:100678633-100678655 CACCAAGAGGGGCCGTGTGGGGG - Intergenic
1113088089 13:106588620-106588642 TTGCCAGAGAGGCTGTGGGGAGG - Intergenic
1115752467 14:36505993-36506015 CGGCCAGAGGGGCAGAGGGTGGG + Intronic
1118464978 14:66022812-66022834 CAGGCAGCTGGGCCGTGAGGAGG - Intergenic
1118547209 14:66904750-66904772 CAGCCAAAGGGTCAGTGGGTTGG + Intronic
1119176305 14:72569904-72569926 CAGCCCGAGGGGCTGGGTGGTGG - Intergenic
1119524457 14:75311050-75311072 CAGCCCGGGGGGCAGTGGGCTGG + Intergenic
1120831404 14:89000705-89000727 CAGCCAGACAGGGCGTGGGAAGG - Intergenic
1121280296 14:92692767-92692789 CAGCCAGAGAAGCAGTGGGGGGG + Intergenic
1122236242 14:100332165-100332187 CAGCCAGTGTGACCCTGGGGAGG + Intergenic
1122245688 14:100401730-100401752 GAGCCTGAGAGGCAGTGGGGAGG + Intronic
1122502760 14:102212337-102212359 CAGCAAGAGGGGCCTTGGGGAGG - Intronic
1122573824 14:102727888-102727910 CAGTCTGAATGGCCGTGGGGTGG - Exonic
1122575400 14:102738710-102738732 CAGCCTGGAGGGCCGTGGAGAGG - Intergenic
1122765857 14:104069410-104069432 CAGCCAGAGAGGCTGAGAGGGGG - Intergenic
1122940626 14:104979441-104979463 CAGGCAGAGGGGACTTGGTGAGG + Intergenic
1122959633 14:105088456-105088478 CAGCCAGCGGGGCCGAGGGGAGG + Intergenic
1123030801 14:105450201-105450223 CAGCCCGAGGGGCCCAGGGCGGG - Intronic
1123717372 15:23041723-23041745 TGGCCAGAGGTGCTGTGGGGGGG + Intergenic
1123717794 15:23043122-23043144 CTGCCAGAGGTGCTGGGGGGCGG + Intergenic
1123717933 15:23043612-23043634 TGGCCAGAGGTGCTGTGGGGGGG + Intergenic
1123718614 15:23045981-23046003 TGGCCAGAGGTGCTGTGGGGGGG + Intergenic
1124958535 15:34376723-34376745 CAACTAGAGGGGGCGAGGGGTGG - Intergenic
1125180651 15:36878512-36878534 CAGCCGGTGGGGGCGGGGGGGGG + Intergenic
1126066097 15:44827517-44827539 AAGGCAGAGAAGCCGTGGGGAGG + Intergenic
1126093738 15:45073047-45073069 AAGGCAGAGAAGCCGTGGGGAGG - Intronic
1128231114 15:66036086-66036108 CAGCCAGAGGGGCCAGGAGCTGG + Intronic
1129780792 15:78269328-78269350 CAGCCAGAGTGGATGTGGTGTGG + Intronic
1130300677 15:82678067-82678089 CAGCCAGAAGGGCCTGGGAGAGG - Intronic
1130543530 15:84839130-84839152 CAGCCAGAGGGCCCTCGGGAGGG - Intronic
1130865952 15:87933484-87933506 CAGCTGGAGGGGCTGTGAGGAGG + Intronic
1132048132 15:98582789-98582811 CAGAGCTAGGGGCCGTGGGGTGG - Intergenic
1132318537 15:100908582-100908604 CAGACAGAGCGGCGGTGTGGGGG - Intronic
1132375146 15:101323868-101323890 CAGAGAGGAGGGCCGTGGGGAGG + Intronic
1132554631 16:567086-567108 CACCGAGAGAGGCCGGGGGGAGG - Intronic
1132579002 16:676617-676639 CAGGCAGGGGTGCCATGGGGAGG + Intronic
1133061809 16:3179850-3179872 CACCCAGAGGGTCCGGGTGGAGG + Intergenic
1133996699 16:10753715-10753737 GAGTCAGAGGGGCTGAGGGGTGG + Intronic
1135326064 16:21526571-21526593 CAGCCACAAGAGCCCTGGGGTGG + Intergenic
1135328988 16:21545673-21545695 CAGCCAGAGGAAACCTGGGGAGG - Intergenic
1135429921 16:22374396-22374418 CAGCCAGAGCCGCCCTCGGGCGG + Exonic
1135766220 16:25179852-25179874 CAGGCGGCGGGGCGGTGGGGGGG - Intergenic
1136339333 16:29631650-29631672 CAGCCAGAGGAAACCTGGGGAGG - Intergenic
1136568805 16:31084850-31084872 CAGGCAGAGGGGCCGCAGGCTGG + Exonic
1136913961 16:34163763-34163785 CTGCCAGACGGGCCGCGTGGCGG - Intergenic
1137505814 16:49052872-49052894 CAGCCAGAGAAGCTGTGGGCGGG + Intergenic
1138113452 16:54342247-54342269 TAGGCAGAGGGGCTGTGGGATGG - Intergenic
1138113527 16:54342632-54342654 CACCTAGAGGGGTCATGGGGTGG + Intergenic
1138281389 16:55774462-55774484 CTGACAGAGGGGACGTTGGGAGG + Intergenic
1138516205 16:57536577-57536599 CCGCCGGAGGGGCCGAGGGAGGG + Exonic
1138567016 16:57840973-57840995 CAGCCAGAGGGACCTTGTGAAGG + Intronic
1139551182 16:67673979-67674001 CTGCCAGAGGCGGCGGGGGGTGG - Intergenic
1139964829 16:70739493-70739515 CAGCCAGAGGGGAGGAGGAGAGG - Intronic
1141527201 16:84618753-84618775 CAGCCTCAGGGGCAGGGGGGTGG - Intergenic
1141661586 16:85444501-85444523 CAGCCTGAGGAACCCTGGGGAGG + Intergenic
1141708144 16:85680971-85680993 CAGCCAGAGGGGCCTTTGAAAGG - Intronic
1141981824 16:87555274-87555296 AAGGCAGAGAGTCCGTGGGGTGG + Intergenic
1142039102 16:87881296-87881318 CAGCCACAAGAGCCCTGGGGTGG + Intergenic
1142263901 16:89054793-89054815 CAGCAAGAAGGCCCGTGTGGTGG - Intergenic
1142586955 17:979800-979822 CAGGCGGAGGGGGCGTGGCGTGG - Intergenic
1142994870 17:3754675-3754697 CAGTCACATGGGCCGAGGGGCGG - Intronic
1143181335 17:4986253-4986275 CGGCCTGAGGGGCCGGGGGGAGG + Exonic
1143477030 17:7208694-7208716 CAGCCAGAGGGGTAGGGGAGGGG - Intronic
1143635289 17:8160966-8160988 CAGCCAGCTGGGGAGTGGGGAGG - Intronic
1144029149 17:11304200-11304222 CAGTGAGAGGGGCCCTGGAGGGG + Intronic
1144711403 17:17403943-17403965 CAGGCAGAGCGGTGGTGGGGAGG - Intergenic
1145388379 17:22435513-22435535 CAGCCAGAGGGACGGCGGGACGG - Intergenic
1147767125 17:42844726-42844748 GATACAGAGGGGCAGTGGGGAGG - Exonic
1147919018 17:43905367-43905389 CAGCCAGAGGGGCCGTGGAGAGG - Intronic
1148051153 17:44770491-44770513 CAGGCAGTGGGGGCGGGGGGGGG - Intronic
1148144605 17:45355140-45355162 GAGCCAGAGGGCCAGAGGGGTGG + Intergenic
1148750032 17:49940353-49940375 CAGCCAGGGGCTCAGTGGGGAGG + Intergenic
1148798117 17:50207137-50207159 CAGCCATAGGGGGCGTGGCCGGG + Intergenic
1149578210 17:57728751-57728773 CTGACTGAGGGGCCGTGGGTGGG - Intergenic
1150644789 17:66971242-66971264 CAGCCAGAAGAGCCTTGAGGAGG + Intronic
1150644796 17:66971271-66971293 CAGCCAGAAGAGCCTTGAGGAGG + Intronic
1151398880 17:73842877-73842899 CAGCCAGAGGGGAGCGGGGGAGG - Intergenic
1151957854 17:77389383-77389405 CTGCCAGAGAGGCCCTGGCGGGG + Intronic
1151978355 17:77494960-77494982 CAGGCAGAGGGGCCAAGGGGAGG - Intronic
1152140653 17:78534538-78534560 CAGAAAGAGGGGCCATGAGGAGG - Intronic
1152206406 17:78976841-78976863 CAGTCACAGGGGCCGTTGTGAGG - Intronic
1152289201 17:79429293-79429315 CACCCTGAGGGGCCCTGGGATGG + Intronic
1152310625 17:79547777-79547799 CAGGGAGAGGGGCTGTGGTGTGG - Intergenic
1152400917 17:80065665-80065687 CAGAGAGAGGGGGTGTGGGGCGG - Intronic
1152557159 17:81059127-81059149 CAGCCTGTGGGGGCGTGGGGGGG - Intronic
1152745053 17:82034686-82034708 CAGGCAGAGGGGCAGGGTGGAGG + Intergenic
1152858422 17:82679951-82679973 CAGCCACAGTGGCTGTGGGAGGG + Intronic
1153041010 18:812589-812611 CAGGCCGAGGGGGCGTGAGGAGG + Intergenic
1154305034 18:13224298-13224320 CACCCAGAGGTGCCATGGGGAGG - Intronic
1156036012 18:32769582-32769604 GAGCCAGAGAGGCCGGAGGGAGG - Intronic
1156498454 18:37541462-37541484 CAGCCAGAGGAGCAATGGTGGGG - Intronic
1157761245 18:50267169-50267191 CGGCGGGAGGGGCAGTGGGGAGG - Intronic
1160349327 18:78160951-78160973 CAGGCAGAGGAGCCCTGGGACGG + Intergenic
1160673803 19:378006-378028 CAGGCAGAAGGGCCCCGGGGAGG + Intergenic
1160739374 19:678949-678971 CAGGCAGAGGAGCCAAGGGGAGG + Intronic
1160860486 19:1235426-1235448 CAGCCCGAGGGGGCGGCGGGTGG + Intronic
1161125300 19:2552853-2552875 CAGACAGTGGGGAGGTGGGGGGG - Intronic
1161267849 19:3373223-3373245 GAGCCAGAGGGGCCAGGAGGTGG - Intronic
1161340775 19:3740774-3740796 GAGCTGGAGGGGCCCTGGGGAGG + Intronic
1161493970 19:4577610-4577632 CTCCCAGTGGGGCCCTGGGGTGG + Intergenic
1161562444 19:4981125-4981147 CAGCCAGTGGGGCCCTGGCAGGG + Intronic
1162318168 19:9953866-9953888 CAGCCAGGGGTGGAGTGGGGTGG - Intergenic
1162524112 19:11197582-11197604 CAGCCGGAGGGGGCGTGGTGCGG - Intronic
1162548107 19:11343161-11343183 AGGCCAGAGGGGCCCTAGGGAGG + Intronic
1162725480 19:12687860-12687882 CAGCCAGAGGTGACTTGGGCCGG + Intergenic
1163378947 19:16951790-16951812 CAGCCTGGGGGGCTTTGGGGAGG - Intronic
1164821976 19:31257521-31257543 CCTCCAGAGGGGTCCTGGGGTGG - Intergenic
1165553298 19:36606599-36606621 CAGGCCGAGGGGGCGGGGGGAGG - Intronic
1166116976 19:40662312-40662334 CAGGCAGAGGGGTCGGGGCGGGG + Intergenic
1166292003 19:41869371-41869393 CAGCCAGAGAGGTCGGGGTGAGG - Intronic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1166686042 19:44796896-44796918 CAGGAAGCGGGGCGGTGGGGGGG + Intronic
1166824668 19:45601422-45601444 CGACCTGAGGGGCAGTGGGGTGG + Intronic
1166860270 19:45806239-45806261 CAGCCAGAGGATGGGTGGGGTGG + Intronic
1167211256 19:48135595-48135617 GAGCCAGAGGAGCAGTGGGTGGG - Intronic
1167427822 19:49438485-49438507 CAGCCAGACGGTCCAGGGGGAGG + Intronic
1167602959 19:50465176-50465198 CAGGCGGAGGGGCGCTGGGGCGG - Intronic
1167607809 19:50490755-50490777 GAGCCAGCGGGACGGTGGGGCGG + Exonic
1167621807 19:50564892-50564914 CAGGCAGAGGTGCTGTGGGTTGG - Intronic
1168167957 19:54566463-54566485 CAGCCAGAAGAGCCGTGGGGTGG - Intergenic
925181521 2:1820053-1820075 CTGGCAGAGGGGCCTGGGGGAGG + Intronic
925192881 2:1899503-1899525 CTGACAGAGGGGCTGAGGGGAGG - Intronic
925380351 2:3420622-3420644 CAGCCACAGCGGCGGTGTGGGGG - Intronic
925846920 2:8043044-8043066 GGGACAGAGGGGCCATGGGGCGG + Intergenic
927690095 2:25202203-25202225 CAGTGGGAAGGGCCGTGGGGTGG - Intergenic
927712291 2:25333286-25333308 CACCGTGAGGGGCCATGGGGAGG + Intronic
927747268 2:25634056-25634078 CAGCCAGGAGGGAGGTGGGGGGG + Intronic
927971365 2:27307805-27307827 CAGCCAGAGGAGCCCCGAGGCGG - Exonic
930053571 2:47235424-47235446 GAGCCAGAGAGCCCATGGGGTGG - Intergenic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932438015 2:71714384-71714406 CAGTCTGAGGGGCCTTGGGAGGG + Intergenic
932574440 2:72955016-72955038 CAGCCAGAGGGGCAGAGGGCAGG + Intronic
934503374 2:94875179-94875201 CAGCAGGAGGAGCTGTGGGGAGG + Intronic
934563969 2:95328220-95328242 AGGCCAGAGGGGCCGGGGGAGGG - Intronic
934898629 2:98139839-98139861 CAGCCTGAGGGGACCTGAGGGGG - Intronic
935051981 2:99531821-99531843 CATCCAGTGGGACCCTGGGGAGG - Intergenic
935247990 2:101236062-101236084 CAGCCAAAGGGTCAGTGGGTTGG - Intronic
936010404 2:108921770-108921792 CGGCCAGATAGGCCTTGGGGTGG - Intronic
937080429 2:119136390-119136412 CAACCTGAGGGGCCATGGGCAGG - Intergenic
937216948 2:120318853-120318875 CAGACAGAGGGGCCGAGAAGGGG - Intergenic
937305389 2:120867546-120867568 CACCCAGAGGGGCGGCGGTGCGG - Intronic
937900253 2:127014377-127014399 CAGACAGAGAGGCAGTGTGGTGG - Intergenic
938127833 2:128687133-128687155 CAGCCAGGGGAGGCTTGGGGGGG + Intergenic
938383143 2:130847883-130847905 CTCTCAGAGGGGCTGTGGGGAGG - Intronic
938574259 2:132589218-132589240 AAGGCAGAGGGGCAATGGGGAGG - Intronic
940368713 2:152877179-152877201 AAGCCAGAAGAGCAGTGGGGAGG + Intergenic
940751206 2:157628818-157628840 CAGCCGCAGGGGGCGTGGGATGG - Exonic
941819087 2:169827346-169827368 CAGCCCGAGGGGGCGTGTGTAGG + Intergenic
944206812 2:197165153-197165175 CAGCCAGAAGGGGCGTGTTGAGG - Intronic
946154778 2:217800351-217800373 CACCCAGAGGGGCAGGGTGGGGG - Exonic
946376046 2:219309391-219309413 CTGCCAGAGGGGCTGAGGCGGGG + Exonic
946615159 2:221501094-221501116 CAGACAGAGTAGCTGTGGGGTGG + Exonic
947728705 2:232416602-232416624 CAGCTACTGGGGCCGTGGTGAGG - Intergenic
947823498 2:233088853-233088875 CATCCAAAGGGGCCTTGGAGAGG + Intronic
947912322 2:233809453-233809475 CATGCAGAGGGGCTGGGGGGCGG + Intronic
948021599 2:234737983-234738005 CAAGCAGAGAGGCCCTGGGGTGG - Intergenic
948600712 2:239106163-239106185 CAGGCAGAGGAGCCGAGGGCGGG + Intronic
948615371 2:239195068-239195090 CAGCCAGAGGGGGCTTCGGTGGG + Intronic
948940521 2:241193415-241193437 CACACAGAGGGGGCGTGTGGAGG - Intronic
949031575 2:241799691-241799713 CAACCAGAGGGGCTGGGGAGTGG - Intronic
1171810114 20:29740838-29740860 CTGCCAGACGGGCCGCGTGGCGG + Intergenic
1171942906 20:31348659-31348681 CAGCCATGGTGGCCATGGGGAGG + Intergenic
1172443080 20:34979271-34979293 CTGGCAGAGGGGCTTTGGGGAGG + Intronic
1172695499 20:36819981-36820003 CAGCCAGTGGGGCCCTGGACGGG + Intronic
1172847811 20:37940309-37940331 CAGCCAGAGGGGCAGCTGGGAGG + Intronic
1173844087 20:46177148-46177170 CAGCCAGTGAGGGCGGGGGGAGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174579854 20:51563722-51563744 CCCCCAGAAGGTCCGTGGGGAGG + Intergenic
1175394485 20:58649580-58649602 AAGACAGAGAGGCCCTGGGGAGG - Intergenic
1175520403 20:59599139-59599161 GAGCCAGCTTGGCCGTGGGGAGG + Intronic
1175790145 20:61735681-61735703 TAGCCACGGAGGCCGTGGGGAGG - Intronic
1175794312 20:61762037-61762059 GAGCCAGGTGGGCCCTGGGGTGG - Intronic
1179253816 21:39697903-39697925 CAGACAGAGGGACTGAGGGGAGG - Intergenic
1179445374 21:41426845-41426867 CATCCACTGGGGCGGTGGGGGGG - Intronic
1179584298 21:42365195-42365217 GAGCCAGAGGGTGTGTGGGGTGG + Intronic
1179584334 21:42365295-42365317 CAGGCAGATGGGCCTGGGGGTGG + Intronic
1179879738 21:44288408-44288430 GAGCCCGAGGGGCCGTGGAGGGG + Exonic
1179924934 21:44529183-44529205 CAACCCGAGGGGCAGTGAGGTGG - Intronic
1179955723 21:44737167-44737189 CAGCCAGGGGAGGGGTGGGGTGG + Intergenic
1180107948 21:45632151-45632173 CACCCAGAGGGGTCGTAGGGTGG + Intergenic
1182023218 22:27098332-27098354 GAGGCAGAGGGCCCGTGGGAAGG + Intergenic
1183186679 22:36295445-36295467 CAGCCAGGGGGGCCTTGGCTTGG - Intronic
1183303060 22:37067903-37067925 CTGCCAGAGGGGCTGAGGTGGGG - Intronic
1183333799 22:37235376-37235398 CAGCCAGCCTGGCAGTGGGGAGG - Intronic
1183349102 22:37324847-37324869 CAGCCAAAGGAGCGGTGCGGGGG - Intergenic
1183354432 22:37350759-37350781 CACCGAGAGGGGCCGCTGGGAGG + Intergenic
1184309327 22:43631095-43631117 CAGCCTGGGGGGCTGTGGGGAGG - Intronic
1184361989 22:44024362-44024384 CATCCTGCGGGGCCGCGGGGTGG - Intronic
1184680745 22:46071202-46071224 CGGCGGGAGGGGCCGCGGGGCGG + Intronic
1185079536 22:48701986-48702008 CACACAGAGGGGACCTGGGGTGG + Intronic
1185320914 22:50199967-50199989 CGCCCAGAGCGGCCGGGGGGAGG + Intergenic
1185347596 22:50317215-50317237 CAGCAGGAGGGGCTGTGGGCGGG - Intronic
950177198 3:10883038-10883060 CAGCCCAAGGGGGCGGGGGGCGG + Intronic
952795976 3:37239429-37239451 CAGCCTATGGGGCCGTGGGTTGG + Intergenic
952940328 3:38439236-38439258 CAGCCAAAGGGTCAGTGGGTTGG + Intergenic
953905258 3:46865400-46865422 CACACAGAGGGGCCCCGGGGAGG + Intronic
954218495 3:49137918-49137940 CAGCCAGGGGGACTGTGGGTGGG - Intergenic
954388631 3:50257717-50257739 GAGCCAGAGGGGCTGTGGCAGGG + Intronic
954619455 3:51987203-51987225 CAGCCTGGGAGGCAGTGGGGTGG + Intronic
956873734 3:73442265-73442287 GAGACAGAGGGGAAGTGGGGAGG + Intronic
957885459 3:86282228-86282250 CAGCCAGCGGGGAGGTGTGGAGG + Intergenic
958497597 3:94864508-94864530 CAGCCTGAGGGGAAGTGGAGAGG + Intergenic
959359042 3:105367164-105367186 CAGCCGAAGGGCCCGTGGGCTGG + Exonic
960392808 3:117100023-117100045 AAGCCAGAGGGGGCCAGGGGTGG - Intronic
960993937 3:123328948-123328970 CAGCCTGAAGGGCACTGGGGCGG + Intronic
961370046 3:126423431-126423453 GAGCCAGAGGGGCAGGGGTGGGG - Intronic
961473969 3:127135674-127135696 ACGGCAGAGGGGCCGCGGGGAGG - Intergenic
961519141 3:127456739-127456761 CTGCCAGAGAGGAAGTGGGGAGG + Intergenic
961626122 3:128264905-128264927 CAGCCAGAGGGGAGGTGGGGCGG - Intronic
966770218 3:183497527-183497549 CACCCAGAGGGGGTGAGGGGAGG + Intronic
966806290 3:183810363-183810385 CAGGCAGAGGCCCCGTGGAGAGG - Intronic
966840469 3:184083406-184083428 CAACCAGAAAGCCCGTGGGGGGG - Intergenic
967330953 3:188288829-188288851 TAGCTAGAGGGGCGGGGGGGTGG - Intronic
968135179 3:196215578-196215600 CGGCCAAAGGGGCCTGGGGGAGG - Intronic
968452896 4:683467-683489 CAGCCAGGGTGGCCCCGGGGTGG - Intronic
968642203 4:1720479-1720501 CATCCAGAGGGACCGCGGCGTGG - Intronic
968909289 4:3469411-3469433 CAGCCAGAGGGTGGGTGGGCAGG + Intronic
969530358 4:7727002-7727024 CACCCTGAGTGGCCCTGGGGTGG + Intronic
969638221 4:8381789-8381811 CAGCCAGGGGGGCCCTGGGCAGG - Intronic
971207349 4:24583881-24583903 CAGCCAGAGGGGCCGTGGGGAGG - Intronic
971211524 4:24622339-24622361 CATGCATAGGGGCCATGGGGTGG + Intergenic
971362443 4:25950538-25950560 AAGCCAGAAGGGGCATGGGGAGG + Intergenic
974597223 4:64030013-64030035 CCCCCAGTGGGGCCTTGGGGTGG - Intergenic
976678575 4:87730413-87730435 CACCCAGAGGAGTAGTGGGGAGG + Intergenic
978372058 4:108038994-108039016 CTTCCAGAGGAGCTGTGGGGTGG - Intergenic
980254902 4:130366463-130366485 TAACCAGAGGGACAGTGGGGAGG - Intergenic
981081342 4:140642187-140642209 TAGCCGGAGGGGCCTTGGGCGGG + Intronic
985539006 5:479205-479227 CAGCCAGGGCGCCCCTGGGGAGG + Intronic
985756690 5:1723598-1723620 CACCCAGAGGGGGTGTGGGAGGG - Intergenic
985828771 5:2212905-2212927 GAGGCAGAGGGGCCGGAGGGTGG + Intergenic
985909426 5:2867273-2867295 CAGGCAGAGGGTCCGTGGAGAGG - Intergenic
985955517 5:3262691-3262713 CAGTCAGAGGAGCTGTGGGCCGG + Intergenic
986042119 5:4003913-4003935 CAGGGAGCGGGCCCGTGGGGAGG - Intergenic
986458439 5:7944011-7944033 GAGCCAGTGTGGCCATGGGGTGG + Intergenic
986681058 5:10233129-10233151 GAGCCAGGGGAGCCTTGGGGAGG - Intronic
991200764 5:63988791-63988813 CAGCCTGCAGGGCCGTGGGTTGG - Intergenic
991609292 5:68434288-68434310 CAGGCAGAGGGGACGTGGGCGGG + Intergenic
992423135 5:76626948-76626970 CAGCCAGAGAGGCAGTAGGCAGG + Intronic
994726115 5:103437567-103437589 CAGTCAGAGTGGGAGTGGGGAGG + Intergenic
998140925 5:139698992-139699014 CAGTCCGTGGGGGCGTGGGGGGG - Intergenic
998214732 5:140228666-140228688 CAGTCAGAGGGGACTTGGAGTGG - Intronic
998562501 5:143184434-143184456 CAGCTGGAGGTGCCGTGGGTGGG + Intronic
998583481 5:143403743-143403765 CCGCCCGAGGGGCCGCGCGGCGG + Intronic
1001248994 5:170131441-170131463 CAGGCAGAGTGGCCACGGGGAGG - Intergenic
1001425204 5:171618159-171618181 CAGCCAGCTGGGCCATGGAGAGG + Intergenic
1001714788 5:173806487-173806509 CAGGAAGAGGGGCCCTGGAGAGG - Intergenic
1002033542 5:176448251-176448273 CGGCCAGAGGTGGCGGGGGGCGG + Intronic
1002279471 5:178122137-178122159 GATCCAGTGGGGCCGTGGGCTGG + Exonic
1002576350 5:180176279-180176301 CAGGCAGAGCAGCCGTGGGAGGG + Intronic
1002600928 5:180353484-180353506 CAGGGAGGGGGGCCGAGGGGCGG + Intergenic
1003290862 6:4776871-4776893 CGGCGAGCGGGGCCGTCGGGCGG - Intronic
1003985025 6:11426785-11426807 CAGCCTGGGGAGGCGTGGGGTGG + Intergenic
1006171732 6:32097072-32097094 CAGCCAGAGGGGACGCTGTGAGG - Intronic
1006298423 6:33180319-33180341 CGGCCAGGGGGGCCCTGGAGTGG + Exonic
1006823933 6:36920031-36920053 CTGACAGTGGGGCCTTGGGGTGG - Intronic
1008624443 6:53303965-53303987 CAACAAGAGGGGCAGTGGAGTGG - Intronic
1009385094 6:63078093-63078115 CAGCCAAAGGGTCAGTGGGTTGG + Intergenic
1011173909 6:84539300-84539322 CAGCCAAATGGGCTGTTGGGTGG - Intergenic
1015163170 6:130175313-130175335 CAGGCTGAGGGCCCGTGGGAGGG - Intronic
1015591834 6:134829801-134829823 CAGCCAGAGGCTCGTTGGGGAGG - Intergenic
1015654338 6:135499629-135499651 CATGCAGAGGTGCAGTGGGGTGG + Intergenic
1017068592 6:150552071-150552093 CAGTCAGGGGGACTGTGGGGAGG + Intergenic
1017456864 6:154608767-154608789 CTGGCAGAGGGGCCGTTGGTCGG - Intergenic
1017798402 6:157869152-157869174 CAGCCAGTGAGGCCGGGGAGAGG - Intronic
1018218059 6:161550180-161550202 CAACAAGGGGGGCAGTGGGGCGG + Intronic
1018856391 6:167678377-167678399 CAGCCATGGGAGCCGTGGTGGGG + Intergenic
1018986746 6:168643526-168643548 CAGGCAGAGGTGCAGTGGTGTGG - Intronic
1019140459 6:169939213-169939235 CTGCCTGAGGGGCCTGGGGGAGG - Intergenic
1019394579 7:810629-810651 GAGCAAGAGAGGCCGTGAGGAGG + Intergenic
1019663906 7:2241939-2241961 GGGCCGGCGGGGCCGTGGGGAGG - Intronic
1019723475 7:2587423-2587445 CAGCCAGCGAGGCAGAGGGGAGG + Intronic
1020130504 7:5556341-5556363 GAGCCACAGGGGCCGCGGGCCGG - Intronic
1020244597 7:6420901-6420923 CCGGCAGAGCGCCCGTGGGGTGG + Intronic
1023598150 7:41854156-41854178 AAGGCACAGGGGCAGTGGGGAGG - Intergenic
1023842309 7:44104434-44104456 AAGCCAGAGGGGCTCAGGGGTGG - Exonic
1023966920 7:44967575-44967597 CAGCCAGAGTGGGAGAGGGGTGG + Intronic
1023990177 7:45124092-45124114 CGGCCAGGGGGGTGGTGGGGAGG + Intergenic
1023998911 7:45178335-45178357 AAGCCAGAGGTGGAGTGGGGTGG - Intronic
1024006023 7:45225234-45225256 CAGCTAGGGGGACCGTGGGCTGG + Intergenic
1024580881 7:50799894-50799916 CAGCCAGAGTGCCCGGGGGAGGG - Intergenic
1024619881 7:51148235-51148257 CAGCCAGAGTGACTGGGGGGTGG + Intronic
1025176045 7:56802989-56803011 CACCTGGAGAGGCCGTGGGGAGG + Intergenic
1026912480 7:74099180-74099202 CAGCCCGGTGGGCCGTGCGGGGG - Exonic
1027124857 7:75549118-75549140 AAGCCACAGGGGTTGTGGGGGGG + Intronic
1029083070 7:97990024-97990046 AAGGTAGAGGGGACGTGGGGCGG - Exonic
1029540469 7:101179621-101179643 CAGCCAAAGGGGGTGGGGGGAGG + Intronic
1029599504 7:101555534-101555556 CAGGCTGTGTGGCCGTGGGGAGG + Intronic
1029750376 7:102539622-102539644 CAGCCAGGAGGACCGTGAGGAGG + Intronic
1029768328 7:102638730-102638752 CAGCCAGGAGGACCGTGAGGAGG + Exonic
1029896519 7:103989767-103989789 CAGCCCGAGAGGGCGGGGGGCGG - Intergenic
1032086881 7:128889051-128889073 GAGACAGAGAGGCCGAGGGGAGG + Intronic
1033239921 7:139669642-139669664 CAGCCAGTGGGCGGGTGGGGGGG + Intronic
1034349821 7:150408400-150408422 CAGCCAGAGGGTCCCGAGGGAGG - Intronic
1034680170 7:152922551-152922573 CAGCCGCAGAGGCCGTGGGAGGG + Intergenic
1035395114 7:158529706-158529728 CAGCCCCAGGGGCTGTGGGGAGG + Intronic
1035431017 7:158821821-158821843 CAGCGCGAGCGGCCGTGTGGAGG - Intronic
1035620192 8:1030815-1030837 CAGCCAGCGGGGCCGCGGGCGGG + Intergenic
1036162969 8:6406455-6406477 CAGCCAGAGGCGCGGCGAGGCGG + Intergenic
1037767774 8:21782520-21782542 CAGGCAGAGAGGACGTGTGGCGG - Intronic
1038423706 8:27451296-27451318 GAGGCCGAGGGGCCCTGGGGAGG - Intronic
1039434049 8:37547471-37547493 CAGGCAGAGGGGCAGGGGAGTGG - Intergenic
1041089432 8:54288381-54288403 AAGCCAGAGGTCCCCTGGGGGGG - Intergenic
1045815087 8:106269980-106270002 CAGCCAGAGGGGCCGCGCGCGGG + Intergenic
1048296552 8:133218947-133218969 CTGACAGAGGGGCTGTGCGGGGG - Intronic
1049203286 8:141352010-141352032 GAGATAGAGGGGCCGAGGGGAGG - Intergenic
1049512902 8:143038775-143038797 AGGCCAGACGGGCGGTGGGGCGG - Intergenic
1053424975 9:38004589-38004611 CAGCCTGAGGGGCAGAGGGTGGG + Intronic
1053885952 9:42645316-42645338 CAGCCGGAGCGGTAGTGGGGTGG + Intergenic
1055728883 9:79260586-79260608 CAGCCAGATGGGCAGTTGGAAGG + Intergenic
1056519576 9:87387774-87387796 CAGCCAGAGAGAGGGTGGGGAGG - Intergenic
1056540088 9:87563725-87563747 CAGTCTGAGAGGCGGTGGGGTGG - Intronic
1056576093 9:87857219-87857241 CAGACAGAGGGGCGGTGGCAGGG + Intergenic
1057130897 9:92654020-92654042 CAGCCATATGTGCTGTGGGGTGG - Intronic
1057206424 9:93175796-93175818 CTGCCACAGGGGCTGTGGTGGGG + Intergenic
1058253938 9:102737387-102737409 CAGTGGGTGGGGCCGTGGGGAGG - Intergenic
1060113804 9:120925768-120925790 CAGCCAGAGGGGCAGTGTCAGGG + Intronic
1060213772 9:121726142-121726164 CTGCCCCAGGGGCTGTGGGGTGG - Intronic
1060594433 9:124839879-124839901 CAGACACAGGGGCCCTGGGCTGG + Intergenic
1060679285 9:125546954-125546976 CAGCCCAAGGAGCCGTGGGAAGG - Intronic
1060796623 9:126516382-126516404 CAGGAAGGGGGGCGGTGGGGGGG - Intergenic
1060991911 9:127854328-127854350 CAGCCAGAGGGAGCGTGCCGCGG + Exonic
1061099959 9:128484955-128484977 CAGCCAGATGGGTAGCGGGGAGG + Intronic
1061377180 9:130233441-130233463 CAGCCGGAGAGGCTGTGGGTGGG + Exonic
1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG + Intergenic
1061732603 9:132627861-132627883 CAGGCAGAGGGGCGTTGGGAGGG - Intronic
1061805149 9:133133593-133133615 CAGCCAGAGTTGCGGTGGGGAGG - Intronic
1061926890 9:133810323-133810345 CAGCACGAGGGGCCGTGATGTGG - Intronic
1062034321 9:134376131-134376153 CAACCAGCGGGGCCGGTGGGAGG - Intronic
1062250028 9:135589241-135589263 CAGCCAGGTGGACAGTGGGGCGG - Intergenic
1062380252 9:136283669-136283691 CAGCCAGAGGGGCAGAGGTGCGG - Intronic
1062433996 9:136538364-136538386 CAGCCAGCGGGACCCTGGGGCGG - Intronic
1062542073 9:137045945-137045967 CAGCCGCAGGTGCCGCGGGGAGG + Exonic
1062612172 9:137380287-137380309 CGCCCAGAGGGGCATTGGGGTGG - Intronic
1062696212 9:137877644-137877666 CAGCCGGAGGGGCCGGGGCGGGG + Intergenic
1203360402 Un_KI270442v1:216577-216599 CTGCCAGACGGGCCGCGTGGCGG + Intergenic
1185457594 X:318630-318652 AATCTGGAGGGGCCGTGGGGCGG - Exonic
1186638542 X:11430885-11430907 CACTCAGAAGGGCAGTGGGGTGG - Intronic
1186896924 X:14012842-14012864 CAGGCAGAGGGGCTATGGGGGGG + Intronic
1188002758 X:24997637-24997659 GAGCCAGAGGGGAGGTGAGGAGG - Intergenic
1188137053 X:26504170-26504192 CAGCCAAAGGGTCAGTGGGTCGG - Intergenic
1189159948 X:38801402-38801424 AAGCCAGAGGGGCGGTGGTGGGG + Intergenic
1190066507 X:47245148-47245170 CAGCTAGAGGAGTTGTGGGGAGG - Intronic
1191634688 X:63363159-63363181 CAGCCACAGGGGACGGGGGAAGG - Intergenic
1192180382 X:68912358-68912380 CAGCAGGAGGAGCCGAGGGGCGG - Intergenic
1195298371 X:103502598-103502620 CACCCAGAGGGGTTGTGGAGTGG + Exonic
1195301636 X:103535832-103535854 CACCCAGAGGGGTTGTGGAGTGG + Intergenic
1199744601 X:150764042-150764064 CAGCCAGTGGCGGGGTGGGGGGG - Intronic
1200252171 X:154559536-154559558 CAGCCAGCAGGGCAGAGGGGAGG + Intronic
1200265597 X:154644880-154644902 CAGCCAGCAGGGCAGAGGGGAGG - Intergenic
1200912834 Y:8546262-8546284 CAGCCCGAGGGGCCCTAAGGTGG + Intergenic