ID: 971207484

View in Genome Browser
Species Human (GRCh38)
Location 4:24584331-24584353
Sequence CCCCGCACGCTTCTTGCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 56}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971207470_971207484 20 Left 971207470 4:24584288-24584310 CCGAGCTGCCGCCTCGCGCCCCC 0: 1
1: 0
2: 4
3: 43
4: 321
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207476_971207484 1 Left 971207476 4:24584307-24584329 CCCCGGCCTGGCTTACCCATCGG 0: 1
1: 0
2: 0
3: 2
4: 103
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207473_971207484 12 Left 971207473 4:24584296-24584318 CCGCCTCGCGCCCCCGGCCTGGC 0: 1
1: 2
2: 2
3: 63
4: 531
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207469_971207484 21 Left 971207469 4:24584287-24584309 CCCGAGCTGCCGCCTCGCGCCCC 0: 1
1: 0
2: 2
3: 32
4: 316
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207480_971207484 -5 Left 971207480 4:24584313-24584335 CCTGGCTTACCCATCGGTCCCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207474_971207484 9 Left 971207474 4:24584299-24584321 CCTCGCGCCCCCGGCCTGGCTTA 0: 1
1: 0
2: 1
3: 15
4: 127
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207479_971207484 -1 Left 971207479 4:24584309-24584331 CCGGCCTGGCTTACCCATCGGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207475_971207484 2 Left 971207475 4:24584306-24584328 CCCCCGGCCTGGCTTACCCATCG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207478_971207484 0 Left 971207478 4:24584308-24584330 CCCGGCCTGGCTTACCCATCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56
971207468_971207484 30 Left 971207468 4:24584278-24584300 CCAACAAAGCCCGAGCTGCCGCC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG 0: 1
1: 1
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971207484 Original CRISPR CCCCGCACGCTTCTTGCCAG AGG Exonic
906345355 1:45011182-45011204 CCGCGTGCGCTTCTTGGCAGAGG - Exonic
920418311 1:205813124-205813146 CCCCAATCGCTTCTTGCCCGCGG + Exonic
1067543157 10:47171707-47171729 CCTCCCACCCTTCTTGCCAAGGG + Intergenic
1075494693 10:122909782-122909804 CCCTGCAGGCTTATTGCCAATGG + Intergenic
1078003332 11:7514302-7514324 CCTCCCAGGCTTCTGGCCAGTGG - Intronic
1088008410 11:104969703-104969725 CTCCGGAAGCTTCTTCCCAGAGG - Intergenic
1091449244 12:562351-562373 CCCCACCCGCTTCTTGCCTAAGG - Exonic
1098438696 12:70496583-70496605 CTCTGCAAGCTTCTTCCCAGAGG + Intergenic
1104047689 12:125174607-125174629 CCCTGCACGCTCCTAGCCAGGGG - Intergenic
1104462168 12:128964756-128964778 ACCTGCAGGCTTCTCGCCAGTGG - Intronic
1105463130 13:20610211-20610233 CCCCCCACCCTGCTTGGCAGTGG + Intronic
1107078257 13:36346516-36346538 CCACGCGCGCGTCTTGCCAGCGG + Intronic
1107160820 13:37225358-37225380 TCCCTCATGCTTCTAGCCAGAGG - Intergenic
1113104514 13:106758330-106758352 CCCTGCAGGCCCCTTGCCAGAGG - Intergenic
1118331113 14:64816804-64816826 CCCCACATGCTTCTTGGCTGAGG - Intronic
1123110858 14:105866319-105866341 CCCAGCCCGCGTCTGGCCAGTGG - Intergenic
1124215390 15:27803959-27803981 CCCATCACGCTTCTACCCAGTGG - Intronic
1130161565 15:81406259-81406281 CCCTGCAAGCTTCTTGGTAGTGG - Intergenic
1132464218 16:70334-70356 CCCTGCACACGTCTGGCCAGAGG + Intronic
1133223388 16:4328652-4328674 CCCCACACACTTCCTGCCACTGG - Intronic
1139528454 16:67530155-67530177 CCCCGCCCGCTTCTCTCAAGCGG - Intronic
1142251850 16:88995586-88995608 CCCAGCCCTCTTCTTCCCAGGGG - Intergenic
1146142651 17:30380683-30380705 GCCCACACACATCTTGCCAGTGG - Intronic
1148722423 17:49763683-49763705 CCCCGCACACTCCGTCCCAGCGG + Intronic
1151769032 17:76147647-76147669 CCCCTCAGGGTCCTTGCCAGGGG - Intronic
1152524188 17:80878134-80878156 CCCAGCATGCTCCTTTCCAGAGG - Intronic
1160565782 18:79785981-79786003 CCCCACCCGCTTGATGCCAGTGG - Intergenic
1165167153 19:33864662-33864684 CCCTGCTGGCTTCTTGCCAGTGG - Intergenic
1167506629 19:49874260-49874282 CCCAGCACACTTCCTTCCAGAGG + Intronic
1167587639 19:50384012-50384034 CCCCGCCCGCCTCTCGCCCGGGG - Intergenic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
927063573 2:19446948-19446970 CACTGCATGCTTCTTCCCAGAGG + Intergenic
927714344 2:25342266-25342288 CCCCGCACGCCGCTTGGCGGAGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932735144 2:74249202-74249224 CCCAGCACACCTCTTGGCAGTGG - Intronic
938780722 2:134582390-134582412 AACCGCACGCTTTTTGCAAGAGG + Intronic
1173823068 20:46030943-46030965 CCCCGCGGGCTTCTGGCCGGAGG + Intronic
1175172851 20:57092227-57092249 CCCCGCACGCTTCTTGCCACCGG + Intergenic
1181643823 22:24219721-24219743 CTCCGCAGGCCTCTTGCCTGGGG - Exonic
1183295280 22:37025517-37025539 ACCCACAGGCTTCTTGCCTGAGG - Intronic
1183737452 22:39651678-39651700 CCCGGCACTGTCCTTGCCAGGGG + Intronic
1184339503 22:43878632-43878654 CCCCACACGCTGCTTGGCAAAGG + Intergenic
1185010248 22:48308957-48308979 CCCAGCACGCCTCATGCCTGAGG + Intergenic
960606208 3:119508127-119508149 CCCCTCAGGCTTCTGGCAAGGGG - Intronic
962341403 3:134587561-134587583 CCCCGGAAGCTTCATCCCAGAGG + Intergenic
967955969 3:194877549-194877571 CCCAGCACACTTCCTCCCAGGGG + Intergenic
969478001 4:7432135-7432157 CCCCGGAGGCTTTCTGCCAGAGG + Intronic
969551084 4:7867686-7867708 CCCCTAACGCTTCTTATCAGGGG - Intronic
971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG + Exonic
976534826 4:86199581-86199603 CCCTGCACGCCCCTTCCCAGTGG - Intronic
990382052 5:55227876-55227898 CCCCGCACTCTTCTCGGCAGTGG + Intergenic
999174041 5:149619088-149619110 CCCTGCAAGCCTCCTGCCAGGGG - Intronic
1021180391 7:17498896-17498918 CCCCCCACCCTTCTTGCCTGGGG - Intergenic
1029610553 7:101624444-101624466 CCGTGCAGGCTTCTTGCCATGGG - Intronic
1034421555 7:150993591-150993613 CCCCCCACCCTTCAGGCCAGCGG + Intronic
1045654035 8:104368356-104368378 CCCCTCAGTCTTCTTCCCAGAGG - Intronic
1048842840 8:138580313-138580335 CCCCACACTGTTCTTTCCAGTGG + Intergenic
1053025758 9:34726953-34726975 CGCCGCACACTTCTCTCCAGAGG + Exonic
1061323803 9:129849805-129849827 TCCCCCAGGCTCCTTGCCAGAGG + Exonic
1062230426 9:135479356-135479378 CCCCGCACGCTCCCTTCCCGCGG + Intronic
1190138854 X:47823161-47823183 CCCCTCACGTTTCTGGCAAGAGG + Intergenic
1191115479 X:56847522-56847544 CCCTGGAAGCTTCTTCCCAGAGG - Intergenic
1198242209 X:134797237-134797259 CCACGCACGCTCCGTGCCCGCGG - Intronic