ID: 971212936

View in Genome Browser
Species Human (GRCh38)
Location 4:24637242-24637264
Sequence GCTCCTAACAGGCCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971212936_971212941 -4 Left 971212936 4:24637242-24637264 CCTGGCTGTGGCCTGTTAGGAGC No data
Right 971212941 4:24637261-24637283 GAGCTGGGCTGCACAACAGGAGG No data
971212936_971212942 22 Left 971212936 4:24637242-24637264 CCTGGCTGTGGCCTGTTAGGAGC No data
Right 971212942 4:24637287-24637309 GCGCAAGTGAACATTACTGCCGG No data
971212936_971212940 -7 Left 971212936 4:24637242-24637264 CCTGGCTGTGGCCTGTTAGGAGC No data
Right 971212940 4:24637258-24637280 TAGGAGCTGGGCTGCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971212936 Original CRISPR GCTCCTAACAGGCCACAGCC AGG (reversed) Intergenic
No off target data available for this crispr