ID: 971216490

View in Genome Browser
Species Human (GRCh38)
Location 4:24666574-24666596
Sequence CCCCTCGTGCATCTGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971216479_971216490 13 Left 971216479 4:24666538-24666560 CCCGGGTGCCCTGGAGCCATGCT No data
Right 971216490 4:24666574-24666596 CCCCTCGTGCATCTGTGCAGGGG No data
971216481_971216490 5 Left 971216481 4:24666546-24666568 CCCTGGAGCCATGCTTGTTAGCC No data
Right 971216490 4:24666574-24666596 CCCCTCGTGCATCTGTGCAGGGG No data
971216480_971216490 12 Left 971216480 4:24666539-24666561 CCGGGTGCCCTGGAGCCATGCTT No data
Right 971216490 4:24666574-24666596 CCCCTCGTGCATCTGTGCAGGGG No data
971216482_971216490 4 Left 971216482 4:24666547-24666569 CCTGGAGCCATGCTTGTTAGCCA No data
Right 971216490 4:24666574-24666596 CCCCTCGTGCATCTGTGCAGGGG No data
971216483_971216490 -3 Left 971216483 4:24666554-24666576 CCATGCTTGTTAGCCACCCACCC No data
Right 971216490 4:24666574-24666596 CCCCTCGTGCATCTGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971216490 Original CRISPR CCCCTCGTGCATCTGTGCAG GGG Intergenic
No off target data available for this crispr