ID: 971219189

View in Genome Browser
Species Human (GRCh38)
Location 4:24689490-24689512
Sequence CAGTGGGAGTGGAGGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971219189_971219204 26 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219204 4:24689539-24689561 AGAGAAAGGGTAGAGGAAAAAGG No data
971219189_971219205 27 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219205 4:24689540-24689562 GAGAAAGGGTAGAGGAAAAAGGG No data
971219189_971219208 30 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219208 4:24689543-24689565 AAAGGGTAGAGGAAAAAGGGGGG No data
971219189_971219206 28 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219206 4:24689541-24689563 AGAAAGGGTAGAGGAAAAAGGGG No data
971219189_971219203 19 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219203 4:24689532-24689554 AGGAAGGAGAGAAAGGGTAGAGG No data
971219189_971219195 -9 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219195 4:24689504-24689526 CTCCCACTGTAAGATTGGTGAGG No data
971219189_971219198 -5 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219198 4:24689508-24689530 CACTGTAAGATTGGTGAGGAAGG No data
971219189_971219200 3 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219200 4:24689516-24689538 GATTGGTGAGGAAGGAAGGAAGG No data
971219189_971219201 12 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219201 4:24689525-24689547 GGAAGGAAGGAAGGAGAGAAAGG 0: 21
1: 432
2: 3576
3: 8070
4: 18057
971219189_971219202 13 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219202 4:24689526-24689548 GAAGGAAGGAAGGAGAGAAAGGG 0: 6
1: 103
2: 715
3: 2495
4: 7876
971219189_971219207 29 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219207 4:24689542-24689564 GAAAGGGTAGAGGAAAAAGGGGG No data
971219189_971219199 -1 Left 971219189 4:24689490-24689512 CCACCATCCCTCCACTCCCACTG No data
Right 971219199 4:24689512-24689534 GTAAGATTGGTGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971219189 Original CRISPR CAGTGGGAGTGGAGGGATGG TGG (reversed) Intergenic
No off target data available for this crispr