ID: 971220877

View in Genome Browser
Species Human (GRCh38)
Location 4:24705002-24705024
Sequence CTCTCTTCACAGCTGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971220871_971220877 6 Left 971220871 4:24704973-24704995 CCTTGCCTTTTCTCTTCCTCTCC No data
Right 971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG No data
971220872_971220877 1 Left 971220872 4:24704978-24705000 CCTTTTCTCTTCCTCTCCTGTCT No data
Right 971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG No data
971220870_971220877 9 Left 971220870 4:24704970-24704992 CCTCCTTGCCTTTTCTCTTCCTC No data
Right 971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG No data
971220868_971220877 29 Left 971220868 4:24704950-24704972 CCGGTTTGTAGGTGTTGCCTCCT No data
Right 971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG No data
971220869_971220877 12 Left 971220869 4:24704967-24704989 CCTCCTCCTTGCCTTTTCTCTTC No data
Right 971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG No data
971220873_971220877 -10 Left 971220873 4:24704989-24705011 CCTCTCCTGTCTCCTCTCTTCAC No data
Right 971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971220877 Original CRISPR CTCTCTTCACAGCTGGAAGA TGG Intergenic
No off target data available for this crispr