ID: 971225871

View in Genome Browser
Species Human (GRCh38)
Location 4:24751108-24751130
Sequence TACAAGAAGTTTAGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971225871_971225878 18 Left 971225871 4:24751108-24751130 CCCCTTCCTCTAAACTTCTTGTA No data
Right 971225878 4:24751149-24751171 CCTTATCGTCTCAGCCATTTGGG No data
971225871_971225876 17 Left 971225871 4:24751108-24751130 CCCCTTCCTCTAAACTTCTTGTA No data
Right 971225876 4:24751148-24751170 CCCTTATCGTCTCAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971225871 Original CRISPR TACAAGAAGTTTAGAGGAAG GGG (reversed) Intergenic
No off target data available for this crispr