ID: 971229164

View in Genome Browser
Species Human (GRCh38)
Location 4:24784879-24784901
Sequence CAGTGCCAAGGTAATTTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971229164_971229167 10 Left 971229164 4:24784879-24784901 CCCATTAAATTACCTTGGCACTG No data
Right 971229167 4:24784912-24784934 TCAATTGACCATGTATGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971229164 Original CRISPR CAGTGCCAAGGTAATTTAAT GGG (reversed) Intergenic
No off target data available for this crispr