ID: 971230231

View in Genome Browser
Species Human (GRCh38)
Location 4:24795554-24795576
Sequence CGCTAACAGCCCAGGCTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971230221_971230231 18 Left 971230221 4:24795513-24795535 CCTCACGCTGACCACTCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 180
Right 971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 134
971230225_971230231 7 Left 971230225 4:24795524-24795546 CCACTCCTCTGGGCTGGCCTCCT 0: 1
1: 0
2: 6
3: 67
4: 544
Right 971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 134
971230226_971230231 2 Left 971230226 4:24795529-24795551 CCTCTGGGCTGGCCTCCTGCACT 0: 1
1: 0
2: 8
3: 42
4: 384
Right 971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 134
971230220_971230231 19 Left 971230220 4:24795512-24795534 CCCTCACGCTGACCACTCCTCTG 0: 1
1: 0
2: 1
3: 23
4: 185
Right 971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 134
971230227_971230231 -10 Left 971230227 4:24795541-24795563 CCTCCTGCACTCGCGCTAACAGC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971230231 Original CRISPR CGCTAACAGCCCAGGCTCCA GGG Exonic
900095165 1:937260-937282 CCCTCACAGCCCAGGGCCCAGGG - Intronic
900180868 1:1310392-1310414 GGCTACCTGCCCAGCCTCCAGGG + Intronic
901696834 1:11013816-11013838 CGGTTACAGCCCAGTTTCCAGGG + Exonic
902785801 1:18731856-18731878 AGTTCACAGCCCAGGGTCCAAGG + Intronic
903236781 1:21955710-21955732 CCCTAAGAGCCCAGGATCGAAGG - Intergenic
904330410 1:29754765-29754787 AGCTCACAGCCCAGGCCCCATGG + Intergenic
904362510 1:29985819-29985841 AAGCAACAGCCCAGGCTCCAGGG - Intergenic
904416268 1:30362831-30362853 AGCTCACAGCCCAGGCCCCATGG - Intergenic
906691779 1:47797620-47797642 GGCTAGCTCCCCAGGCTCCAGGG + Intronic
908783025 1:67708944-67708966 CACTAGCAACCCAGACTCCAGGG + Intronic
913576570 1:120181097-120181119 CGCACACATCCCAAGCTCCAAGG - Intergenic
914716989 1:150261637-150261659 AGGTAAAAGCACAGGCTCCAAGG + Exonic
916036184 1:160924426-160924448 TTCTAACAGCCCAGACTCCTTGG - Intergenic
917551104 1:176030346-176030368 CTCTAACAGCCTAGGCCCAAAGG + Intronic
920848300 1:209611594-209611616 CCCTGCCAGCCCAGCCTCCAGGG - Intronic
922007699 1:221548985-221549007 TGCTAACATCCCAGGTGCCAAGG + Intergenic
1063427564 10:5961922-5961944 CGCTCACTGCCAATGCTCCAGGG + Intronic
1065888167 10:30097307-30097329 CACTAATACCCCAGGCTGCAGGG - Intronic
1065932866 10:30494801-30494823 GGCTAAAGGCCCAGGCTGCAGGG + Intergenic
1068938408 10:62657815-62657837 CACAAACAGCCAAGGCGCCATGG + Intronic
1069024252 10:63522156-63522178 CGCTCCCAGCCCAGGATCCCTGG + Intronic
1069540169 10:69288270-69288292 CACTTCCAGACCAGGCTCCAGGG + Intronic
1070151550 10:73808295-73808317 CGCTTTCAGCCTGGGCTCCATGG - Exonic
1071563647 10:86660708-86660730 CGCCAGCAGCACAGGCTCCAAGG + Intronic
1072683202 10:97521437-97521459 CTCTGAGAGCCCAGCCTCCAGGG + Intronic
1073506255 10:103994751-103994773 GCCAAACAGCCCAGGTTCCATGG - Intronic
1075116254 10:119629593-119629615 CCATAACAGCCCATGCCCCATGG - Intergenic
1081158566 11:39725441-39725463 TGTTAACAGTCCAGACTCCAAGG + Intergenic
1083190977 11:61052378-61052400 GGATTAGAGCCCAGGCTCCAGGG - Intergenic
1088235583 11:107719385-107719407 CCCTACCAGGCCAGGCTCTAGGG - Intronic
1089703518 11:120260266-120260288 AGCCAACAGCCCAGGCTAGAAGG - Intronic
1101870699 12:108562982-108563004 CGCCAACAGCCCAGGAGGCAGGG + Intronic
1104138142 12:125959950-125959972 CAGTAACAGTCCATGCTCCATGG + Intergenic
1104889474 12:132133282-132133304 CCCCATCAGCCCCGGCTCCAAGG - Intergenic
1105542586 13:21327809-21327831 CACTGACACCCCAGGCTCCTGGG - Intergenic
1106249703 13:27974149-27974171 TGCTAGGAGCCCAGGCTCCCCGG + Intergenic
1108056918 13:46494330-46494352 CGTTAACAGCCCAGGTTTCATGG - Intergenic
1113561235 13:111283295-111283317 CGCAGGCAGCTCAGGCTCCAGGG - Exonic
1118908833 14:70044550-70044572 CTCCAAAAACCCAGGCTCCAAGG + Exonic
1119680129 14:76585809-76585831 CGGGACCAGCCCAGCCTCCACGG - Intergenic
1120980917 14:90288264-90288286 TGCAAACAACCAAGGCTCCAAGG + Exonic
1121009205 14:90510030-90510052 GGCTCAAAGCCCAGGCTCCAGGG + Intergenic
1124019160 15:25903806-25903828 CCCACACAGCCCAGGTTCCAGGG + Intergenic
1125790790 15:42364159-42364181 GGCTAAGAGCCCAGGCTCTGAGG + Intronic
1126541752 15:49831726-49831748 GGCGAGCATCCCAGGCTCCATGG - Intergenic
1130622593 15:85479249-85479271 AGCCACCAGCCCAGGCTCCGTGG + Intronic
1132492529 16:241008-241030 CGCTCACCTCCCAGGCTCAAGGG + Intronic
1132508037 16:322274-322296 GGCGCACACCCCAGGCTCCAGGG + Intronic
1132713812 16:1280609-1280631 GGCTGCCAGCCCAGGCTCCCTGG - Intergenic
1133101944 16:3485228-3485250 AGCTAACACAGCAGGCTCCATGG + Intronic
1133849747 16:9491327-9491349 AGCTAACAGCCTTGGCTCCCAGG - Intergenic
1141181095 16:81753911-81753933 GGCCAACAGCCAGGGCTCCATGG + Intronic
1143756603 17:9072225-9072247 AGCAAATAACCCAGGCTCCAGGG - Intronic
1146724502 17:35146799-35146821 AGCTCACAGCCCAGGCTTGAGGG + Intergenic
1148143811 17:45347106-45347128 CGCTAAAAGCTCAGACTCCTGGG + Intergenic
1148343900 17:46890719-46890741 TTCCAACAGCCCAAGCTCCAAGG + Intergenic
1151020965 17:70617010-70617032 AGCTAAGAGCCAAGGCTCGAGGG + Intergenic
1153698101 18:7664436-7664458 TGAGAACAGCGCAGGCTCCAGGG - Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1158806847 18:60983871-60983893 TTCTAGCAGCCCAAGCTCCAGGG - Intergenic
1160731534 19:643628-643650 CGCCACCAGCCCAGGCACCTTGG - Exonic
1161016951 19:1987851-1987873 CCCTAAAAGCCCAGGCAGCAGGG - Intronic
1163643199 19:18473466-18473488 GGCTCCCACCCCAGGCTCCAAGG - Intronic
1164801785 19:31083176-31083198 CCCTGACAGCCCAGTGTCCAGGG - Intergenic
1166545920 19:43634964-43634986 TGCTGACAGCCCAGACTCCTGGG - Intronic
1167355804 19:49003318-49003340 CTCTACCTGCCGAGGCTCCAAGG - Exonic
928470297 2:31568728-31568750 CACTAACAGCCTGGGCACCATGG - Intronic
929847181 2:45542066-45542088 CACAAACAGCCCATGCACCATGG - Intronic
933726682 2:85431062-85431084 TCCTGACAGCCCAGTCTCCATGG - Intronic
934889024 2:98049514-98049536 CTCTAACAGCCTAGACTCCTTGG + Intergenic
937323495 2:120974864-120974886 CTGTAACAGCCCAGGGTCCTTGG + Intronic
937905908 2:127052687-127052709 CGCTGGCAGCCCAGGCTCCTGGG - Intronic
938116170 2:128604198-128604220 CCCTCACAGCCCAGGCACCCAGG + Intergenic
940069475 2:149669609-149669631 AGACAACAGCCCAGGCTCCATGG + Intergenic
946004419 2:216510908-216510930 CCCTAACAGCCCTCCCTCCATGG - Intronic
948154821 2:235772798-235772820 CGCTTGCATCCCAGGCTCCGAGG - Intronic
948477857 2:238231969-238231991 CGGTTACAGCCCAGTTTCCAGGG + Intergenic
948864573 2:240768777-240768799 TGTGAGCAGCCCAGGCTCCAGGG + Intronic
949011071 2:241678896-241678918 CACCCACAGCCCAGGCCCCATGG + Intronic
1170500978 20:16974991-16975013 CGCTAGCAGCCTGGGCGCCACGG + Intergenic
1172165079 20:32893968-32893990 GGCTAAAAGCACAGACTCCAGGG - Intronic
1175794077 20:61760457-61760479 GGCTGAGAGCCCAGGCTCCAGGG + Intronic
1176001372 20:62832883-62832905 GGCCAAAAGCCCAGGCCCCAGGG - Intronic
1177404298 21:20645726-20645748 CACTAACAGCCGGGGCACCATGG + Intergenic
1179413192 21:41177923-41177945 GGCAAACAGACCTGGCTCCATGG + Intronic
1179879376 21:44287095-44287117 CGCCAGCAGCCCTGACTCCAAGG + Exonic
1182255734 22:29036993-29037015 CGCTAACAGTCCAGCTTCCTTGG + Intronic
1182429791 22:30292736-30292758 CGCTCCCCGCCCAGGCTGCATGG - Exonic
1182846608 22:33436457-33436479 TGCTAAAAGCACAGGCTCCTGGG + Intronic
949235292 3:1801877-1801899 CGCTGTCACCCCAGGCTGCAGGG + Intergenic
950107655 3:10398514-10398536 CCCCAGCAGCCCAGGCTTCACGG + Intronic
952866630 3:37859892-37859914 GTGTAATAGCCCAGGCTCCAGGG - Intergenic
954785517 3:53089648-53089670 TGCTGACAGCCCAGGCGGCAGGG + Exonic
959577864 3:107953982-107954004 CCCTAACAGCCCGTGTTCCATGG + Intergenic
962886018 3:139628634-139628656 AGGAAACAGCCCAGGCTCCAGGG + Intronic
965282462 3:166771193-166771215 TGCTAGAAGGCCAGGCTCCAGGG + Intergenic
966783415 3:183604110-183604132 AGCTTTCAGCCCTGGCTCCATGG + Intergenic
967224362 3:187276640-187276662 TGCAAACAGCACAGGCTTCAGGG - Intronic
967807751 3:193730579-193730601 AGCAAGCAGCCCAGGCTCCAGGG - Intergenic
971048481 4:22832176-22832198 CAGTAGCAGCTCAGGCTCCAGGG - Intergenic
971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG + Exonic
973979493 4:56296060-56296082 CTCTCACAGTCCAGGCCCCATGG + Intronic
977879396 4:102186916-102186938 CACTAAAAGCCCAGGCTTCACGG + Intergenic
992089253 5:73303244-73303266 CACTAACAGCCCTGACTCCCGGG - Intergenic
995901213 5:117069021-117069043 AGTTAAGAGCACAGGCTCCAGGG - Intergenic
997830237 5:137143411-137143433 CGGGAACAGCACAGACTCCAAGG + Intronic
998310388 5:141123821-141123843 GCCGAACAGCCCAGGCTCCGTGG - Exonic
999244749 5:150147944-150147966 CGCGCACAGCCAAGACTCCACGG + Intronic
999362801 5:150999921-150999943 CTCCAACAGGTCAGGCTCCAAGG + Intergenic
1001549982 5:172595799-172595821 CGCTAACAGCCCAGGGGAAAGGG - Intergenic
1002415531 5:179119073-179119095 CGCCTACAGCCCAGGTGCCAAGG - Intronic
1002792756 6:447761-447783 TGCAAACAGCCCAGGCCGCAGGG + Intergenic
1003409424 6:5850007-5850029 CACTGACACCCCAGGCTCCTGGG + Intergenic
1004145503 6:13062339-13062361 GGCTAACAGCCCAGGGTTAAGGG - Intronic
1006914538 6:37585836-37585858 CTCTGAGACCCCAGGCTCCAGGG - Intergenic
1011070802 6:83380668-83380690 GCCTAACATCCCAGGCTCCCAGG - Intronic
1019078765 6:169412939-169412961 GGCAAACAGCACAGGCTGCATGG + Intergenic
1019624691 7:2009994-2010016 CTCCCACAGCCCAGACTCCAGGG + Intronic
1023020341 7:36006483-36006505 CTCTAACAACCCTGACTCCACGG + Intergenic
1024610317 7:51058775-51058797 CTCTAACAGCCCACGCTCAGAGG - Intronic
1027672625 7:81120166-81120188 CCCTCCCTGCCCAGGCTCCAGGG - Intergenic
1030473596 7:109999426-109999448 AGCTGACAGCCCAGGATCCAAGG - Intergenic
1032193084 7:129775480-129775502 CACCAGCAGCCCAGGCTCCTAGG + Intergenic
1032395974 7:131590344-131590366 TGCTAGAAGCCCAGGCTACACGG + Intergenic
1036203471 8:6788208-6788230 GGCAAAGATCCCAGGCTCCATGG + Intergenic
1037946088 8:22990560-22990582 CACCAGCAGCCCAGGCTCCCAGG + Intronic
1042411539 8:68472281-68472303 GGGTAAGAGCCCAGGCTCCTGGG - Intronic
1042468937 8:69161418-69161440 GGCTAAAAGCACAGACTCCAGGG + Intergenic
1043561421 8:81498263-81498285 ATCTTGCAGCCCAGGCTCCAAGG - Intergenic
1046187049 8:110734838-110734860 CACAAACAGCCCGGGCACCATGG - Intergenic
1047966767 8:130050798-130050820 CCCCGACAGCCCAGCCTCCAAGG - Intergenic
1053283964 9:36838737-36838759 CTCTCACAGCCCCGGCTCCCTGG + Exonic
1055374957 9:75638277-75638299 CGTTAACAGCCCAGGCTAGTGGG + Intergenic
1057038072 9:91826084-91826106 AGTTAACAGCCCAGGCTCCCTGG + Intronic
1057764526 9:97904916-97904938 CGCTGACAGCACAGCCTCAATGG + Exonic
1058372322 9:104284235-104284257 GGCTAAAAGCACAGACTCCAGGG + Intergenic
1060656177 9:125374219-125374241 CCCTAGGAGCACAGGCTCCAGGG - Intergenic
1062266250 9:135687775-135687797 GGCTGACACCCTAGGCTCCAGGG + Intergenic
1185648066 X:1629184-1629206 CACTAAAAGCCTAGGCTGCAAGG - Intronic
1186745425 X:12563128-12563150 CATTGACAGCCCATGCTCCAAGG - Intronic
1190657196 X:52622974-52622996 GTCTATCAGTCCAGGCTCCAGGG - Intergenic
1190661099 X:52654888-52654910 TTCTATCAGTCCAGGCTCCAGGG - Exonic
1190962781 X:55268809-55268831 CTCTAACAGCCAAGACTCCTTGG + Intronic
1193575053 X:83186067-83186089 CGCGAACAGCCTGGGCACCATGG - Intergenic
1193656366 X:84203035-84203057 CACTAACAACTCAGGCTCAATGG - Intergenic
1195129375 X:101838980-101839002 CACTGGGAGCCCAGGCTCCAGGG + Intronic
1195176863 X:102320849-102320871 CACTGGGAGCCCAGGCTCCAGGG - Intronic
1195182001 X:102366244-102366266 CACTGGGAGCCCAGGCTCCAGGG + Intronic