ID: 971231024

View in Genome Browser
Species Human (GRCh38)
Location 4:24800253-24800275
Sequence GTCCCTGGCCGCCGCCGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971231024 Original CRISPR GTCCCTGGCCGCCGCCGGGT GGG (reversed) Exonic
900213973 1:1471508-1471530 GTCCCGGCCCGCAGCCGCGTCGG - Intergenic
900307759 1:2019407-2019429 GTCCATGGCCGCGGCGGGCTCGG - Exonic
901060758 1:6470926-6470948 GACCCTGGACGGGGCCGGGTGGG - Intronic
903493087 1:23743917-23743939 GGCGCTGGCCGCCGCCTCGTTGG + Intronic
907450391 1:54542398-54542420 GGCCCTGCACGCCGCCGGGGCGG + Intronic
910759453 1:90719794-90719816 GTGACTGGGCCCCGCCGGGTGGG + Intergenic
912474230 1:109925408-109925430 GTCCCTGGCCTCAGCGGGGGTGG - Intronic
922571829 1:226638940-226638962 GTCCCTGGCGTGCGGCGGGTAGG - Intronic
923372630 1:233328232-233328254 GTCGCAGGACGCCGCCGTGTCGG + Exonic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1076563694 10:131383720-131383742 GTCCCTGGCCACCGCAGTGCAGG - Intergenic
1077361180 11:2140742-2140764 GTCTCCGGCTGCCGCCGGGGAGG - Intronic
1077495923 11:2886359-2886381 GGCCCTGGCCTGCGCCGGATGGG + Intergenic
1077891100 11:6418887-6418909 GACCCGGGCTGCCGCAGGGTAGG + Intronic
1081545049 11:44065968-44065990 GTGCTGGGCCGCCGCCGGGCCGG - Intronic
1083995067 11:66267654-66267676 GTGCCTGGGCGGGGCCGGGTGGG - Exonic
1084185435 11:67468708-67468730 GCACCTGGCCCCCGCTGGGTTGG - Intronic
1089814737 11:121162294-121162316 CTCCCTGGCCGCCTACGGGGAGG + Exonic
1095987766 12:48010864-48010886 GGCCCTGGCTGCCTCCGGATAGG - Intergenic
1101090484 12:101280125-101280147 GCCCCTGGGCGCCGCCATGTTGG - Exonic
1104061501 12:125272383-125272405 GTCCCTGTCCCCCAGCGGGTGGG + Intronic
1105303469 13:19154234-19154256 GTCCCAGGCAGCAGCTGGGTGGG + Intergenic
1106602737 13:31200786-31200808 GCCCCTGTCCTCCTCCGGGTCGG - Intronic
1114653274 14:24300067-24300089 AACCCTGGCCGCCTCCGGATGGG + Exonic
1116958043 14:50944092-50944114 GTCTCCGGCCGCGGCCGGGCGGG - Intronic
1118320303 14:64748843-64748865 TTCCCTGGCTGCCACCAGGTGGG + Exonic
1118930174 14:70234224-70234246 TTCCCTGGTCGCCGCCGCGGTGG + Intergenic
1121691005 14:95876998-95877020 CCCGCTGGCCGCCGCCGGATAGG - Intergenic
1122293488 14:100692332-100692354 GTCCCTGCCCGGCGCCGGGCTGG + Intergenic
1122401427 14:101469686-101469708 GCCCCTGGCCGCTGACTGGTTGG - Intergenic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1122878120 14:104678112-104678134 GTCCTCTGCCGTCGCCGGGTGGG - Intergenic
1123042340 14:105495551-105495573 GTCCCTGGCTGAAGCCGGGCTGG + Intronic
1124211798 15:27770303-27770325 GTCCCTGGCCCCTCCCGGCTTGG - Intronic
1125577167 15:40763934-40763956 GTCCAAGTCCGCCGCCGGGAGGG + Intergenic
1132799728 16:1746080-1746102 GTCCCAGGCAGCCGCTGGGTGGG - Intronic
1132855285 16:2042208-2042230 GTCCCTGCCCGCAGCCAGGCAGG - Intronic
1132889305 16:2196253-2196275 CTCCCCGCCCGGCGCCGGGTGGG + Intronic
1132889546 16:2196913-2196935 GCCCCGCGCCGCCGCCGCGTCGG - Intergenic
1133464922 16:6019759-6019781 GACCCTGGCGGCCACTGGGTGGG - Intronic
1136536393 16:30902323-30902345 GGCCCTGGGCGCCGCCGTGGAGG + Exonic
1146329690 17:31917220-31917242 GGCCCCGGCCGCCGCCGGGCAGG - Intergenic
1150394394 17:64809965-64809987 GCCCCTGGCCCCAGGCGGGTGGG + Intergenic
1151492283 17:74439857-74439879 GGCCTTGGCTGCAGCCGGGTGGG - Exonic
1151783831 17:76265630-76265652 GAGCCTGGCCGCCGCGGGGCCGG + Intronic
1152139732 17:78529404-78529426 GTCCATGGTCGCGGCCGGGATGG + Intronic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1157278986 18:46333811-46333833 GTCCCTGGCCGCCCGCGGGCCGG - Intronic
1157833486 18:50878754-50878776 TTCCCTGGCCTCCGCGGGTTCGG + Intergenic
1160869253 19:1269529-1269551 GTCCCTCGCCGCCGGCGGGGCGG - Intronic
1160874577 19:1291123-1291145 GTCCCTGGCTTCCCCCGGGCCGG - Intronic
1162901024 19:13795626-13795648 GGCCCTGGCCCCGGCCGGGCCGG + Exonic
1163144303 19:15370246-15370268 GTCCCTGGCCACTGCCTGGTGGG + Intronic
1163360458 19:16842807-16842829 CTCCCTGGCCCCGGACGGGTTGG - Intronic
1164686024 19:30167389-30167411 GTCCCTGCCCACTGCAGGGTGGG + Intergenic
1165091133 19:33388938-33388960 GGCCCTGGCCGCCGGCCGGATGG - Intronic
1165745800 19:38229073-38229095 GGCCCTCGCGGCCGCAGGGTGGG - Intronic
1165916717 19:39265216-39265238 GCCCCTGGCAGCCGCGGGGAGGG + Intergenic
1166313227 19:41975023-41975045 GTCCCTGGCTTCCCCCTGGTTGG + Intronic
1167272414 19:48513482-48513504 GTGCCAGGCCGCCGCCGTCTCGG + Intergenic
1167454465 19:49591285-49591307 GTCCCGGGCGGCCCCGGGGTGGG - Intergenic
1168339252 19:55614208-55614230 GTCGCAGGCCGCCGCCGCGGGGG - Exonic
927606698 2:24491962-24491984 GCCCCGGGCCGCCGCCGAGAGGG + Exonic
928178226 2:29049587-29049609 GTCCCTGTCAGCCCCAGGGTGGG - Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
932343124 2:70979012-70979034 ATCCCTGGCCCCCGCCTGGCTGG - Intronic
934518479 2:95004507-95004529 GTCACTGGCTGCCGCAGGCTTGG + Intergenic
934655306 2:96114253-96114275 GTCCCTGGCAGGCGCTGGGATGG - Exonic
936278670 2:111120587-111120609 CGCCGCGGCCGCCGCCGGGTTGG + Intronic
946412634 2:219522733-219522755 CTCCCCGGCCGCCGCGGGGGCGG + Intronic
947506690 2:230713158-230713180 GTCCTCGGCCGCCGCCGCTTCGG - Exonic
1168790278 20:571794-571816 GTCCCTGCCACCCGCCTGGTAGG - Intergenic
1175283970 20:57824933-57824955 GTCCCTGGGCTCCCCCTGGTTGG + Intergenic
1175925128 20:62467662-62467684 GGCCCTGGCTGCCGCCGGGAGGG - Intronic
1176186975 20:63785747-63785769 GTCACTGGCCGCCACAGCGTGGG + Intronic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1181694976 22:24588484-24588506 GTGCCAGGCCACAGCCGGGTTGG - Intronic
1184679300 22:46061745-46061767 GTCCCAGGCCGGGGTCGGGTCGG - Intronic
949546875 3:5080181-5080203 CTCCCTGGCTGCCCCAGGGTGGG + Intergenic
950729725 3:14947398-14947420 GGCCTTGGCCGCGGCCGGGCGGG - Intergenic
956147005 3:66200318-66200340 TTCCCTGGCAGGTGCCGGGTGGG + Intronic
961454471 3:127017264-127017286 GTCCCTGGTCCACGTCGGGTGGG + Intronic
966734530 3:183178851-183178873 GTCTGCGGCCCCCGCCGGGTTGG + Exonic
966831936 3:184017543-184017565 GTCCCTGGCCGCGGCCGCCAGGG - Intronic
968225179 3:196968727-196968749 GACCCTGGCCCTCGCCGGGCAGG - Exonic
969325814 4:6443208-6443230 GTGCCCGGCCGCCGCCTGGCAGG + Intronic
969568477 4:7993878-7993900 GTCCCTGGCTGGCCCTGGGTGGG + Intronic
970394718 4:15654905-15654927 GTCACTGGCCGCCCTCGGGCCGG - Intronic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG + Intergenic
977323443 4:95547892-95547914 GGCCCTGGGCGAAGCCGGGTTGG - Intronic
982610964 4:157574463-157574485 GTCCCTTGCCCCCGCAGGCTCGG + Intergenic
985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG + Exonic
1000209521 5:159097122-159097144 GTCTTTGGCCGCAGCGGGGTGGG - Exonic
1003099082 6:3163228-3163250 GTCCCTGCCCGTCGCCGGCAAGG + Intergenic
1003958719 6:11190110-11190132 GTCCCTGGGAGCCACCGTGTGGG + Exonic
1005931695 6:30489646-30489668 GTCCTTCGCCCCCGCCGGGCCGG - Intronic
1007114734 6:39335600-39335622 CTCCCTGGCTGCAGCTGGGTTGG + Exonic
1012916894 6:105180042-105180064 GCCCCGGGGCGCAGCCGGGTGGG + Intergenic
1018986044 6:168637986-168638008 TTCCCTGGGCGCTGCAGGGTGGG - Intronic
1019492848 7:1323183-1323205 GCCCCTGGCCAGCCCCGGGTGGG - Intergenic
1019639777 7:2097174-2097196 GTGCCTGGGCGCCGTGGGGTGGG - Intronic
1021600224 7:22356988-22357010 GGCCCTGGCCGCCGCGGCGGCGG - Intronic
1026888291 7:73967331-73967353 GGCCCTGGCCACAGCCGGGAAGG - Intergenic
1029683036 7:102125457-102125479 GTCCCTGGCCGCCGCTGGGAGGG + Intronic
1032540687 7:132700450-132700472 GTCCCTGGCCCCTGCTGTGTTGG - Intronic
1034985901 7:155515302-155515324 GTTCCTGGCCGGGGCCGGGGGGG - Intronic
1036910584 8:12754712-12754734 GGCCCTGGCCGCCGCCTGCGAGG - Exonic
1037891574 8:22626587-22626609 GTGCCTGGGAGCTGCCGGGTAGG + Intronic
1040501445 8:48008638-48008660 GGCCCCGGCGGCCGTCGGGTTGG + Intronic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1062362267 9:136193627-136193649 CGCCCTGGCCGCCGCGGGGAGGG - Intergenic
1192795716 X:74422679-74422701 GTCTCTGGCCGCCGCCGTTACGG + Intronic
1197775980 X:130119057-130119079 GTCCCTGGCCACCTCCGTCTTGG - Intergenic
1200092931 X:153644254-153644276 GCCCCGGGCCTCCGCCGGGCCGG - Intronic
1200092962 X:153644327-153644349 CTCGCTGCCCGCCGCAGGGTGGG - Intronic
1200209890 X:154342492-154342514 CTCCCTGGACGCTGCCGGGTGGG - Intergenic
1200220962 X:154389600-154389622 CTCCCTGGACGCTGCCGGGTGGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic