ID: 971231024

View in Genome Browser
Species Human (GRCh38)
Location 4:24800253-24800275
Sequence GTCCCTGGCCGCCGCCGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971231024 Original CRISPR GTCCCTGGCCGCCGCCGGGT GGG (reversed) Exonic