ID: 971232997

View in Genome Browser
Species Human (GRCh38)
Location 4:24815830-24815852
Sequence CTTTTTAAGCAGTGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971232993_971232997 7 Left 971232993 4:24815800-24815822 CCTCTGAGATTAGCAGGGAGAAC 0: 1
1: 0
2: 2
3: 16
4: 119
Right 971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971232997 Original CRISPR CTTTTTAAGCAGTGGGTGCA GGG Intronic
904279298 1:29407594-29407616 CTTAGTATGCAGTGGGGGCAAGG - Intergenic
904447201 1:30584403-30584425 CATTTAAAGCAGTGTGTACAGGG - Intergenic
906677770 1:47705664-47705686 CTTTCCAAGCTGGGGGTGCAGGG + Intergenic
907491583 1:54812061-54812083 CTTTTGAAGAAGTAGGTGCCGGG - Exonic
908576437 1:65465176-65465198 CTTTTAAAGCAGTGTGTAGAGGG - Intronic
910129702 1:83889023-83889045 CTTTTTTAGCAGTGCGAGAATGG - Intronic
910339085 1:86165493-86165515 CATTTAAAGCAGTGTGTACAGGG - Intergenic
910814187 1:91272357-91272379 TTTTTTAAGAAGTTGCTGCATGG - Intronic
910860162 1:91735090-91735112 GTTTTTAAGCAGCGGATTCAAGG + Intronic
912868990 1:113286088-113286110 CTATTTAAGCTGTGTGTGCTTGG - Intergenic
913080954 1:115386472-115386494 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
913478641 1:119263317-119263339 CTTTTTAAGCAGTAGCAGTATGG + Intergenic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
915318619 1:155043693-155043715 CTTTTAAGGCAGTGGGAACATGG - Intronic
915426674 1:155833338-155833360 CTTTTTTTGCAGTGGGAGAATGG - Intronic
915851214 1:159325796-159325818 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
917207638 1:172594431-172594453 CATTTAAAGCAGTGTGTACAGGG - Intronic
921379160 1:214506031-214506053 CTGCCTAAGCAGTGGATGCATGG - Intronic
922552066 1:226502407-226502429 CTTTTGAAGCAGTGTGTAGAGGG - Intergenic
923643244 1:235787363-235787385 CTTTTTCTGTAGTGTGTGCATGG - Exonic
924298795 1:242615594-242615616 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1062993873 10:1847146-1847168 TTTTTTGAGTTGTGGGTGCAGGG + Intergenic
1063089812 10:2853494-2853516 CTTTTTAAGGGCTGGCTGCAGGG - Intergenic
1065542895 10:26787847-26787869 TTTTTTAACCAGTGGGTCTAAGG - Intronic
1066784900 10:38992762-38992784 CATTTAAAGCAGTGTGTACAGGG - Intergenic
1067335707 10:45361746-45361768 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1067369366 10:45668888-45668910 CATTTAAAGCAGTGTGTACAGGG + Intronic
1069266842 10:66469553-66469575 TATATTAAGCAGAGGGTGCAAGG + Intronic
1070713664 10:78701933-78701955 CTTGAAAAGCAGTGGGTGCCCGG - Intergenic
1074000773 10:109370223-109370245 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1075172779 10:120131336-120131358 CTTTTTCAGCACTAGGTCCAGGG + Intergenic
1076259628 10:129055139-129055161 CTTTGTCACCAGTGAGTGCAGGG - Intergenic
1077206738 11:1348429-1348451 CTGCTTAAGCAGTGGGTGGCTGG - Intergenic
1079998840 11:27324434-27324456 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1080346581 11:31332530-31332552 CATTTAAAGCAGTGGGTAGAGGG - Intronic
1080679747 11:34463160-34463182 CTGTTTAGGCAGTGTGTGCTCGG + Intronic
1082136235 11:48552507-48552529 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1083210422 11:61181257-61181279 TTTTTTAAGTAGGGGGAGCATGG + Intergenic
1083738527 11:64695230-64695252 CTTTTCCAGCAGTGGGAGGAGGG - Intronic
1083894725 11:65614132-65614154 CTTTTTGCGCAGGGGGTGGAGGG + Exonic
1085012493 11:73150968-73150990 GGTCTTGAGCAGTGGGTGCATGG - Intergenic
1086030126 11:82344603-82344625 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1086691545 11:89792734-89792756 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1086811773 11:91319441-91319463 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1087470669 11:98570204-98570226 CATTTTAAGTAGAGGGTCCAAGG - Intergenic
1088042368 11:105402844-105402866 CATTTTTAGGAGGGGGTGCAGGG + Intergenic
1088631634 11:111779194-111779216 CTTCTTCAGCAGTGGGTACCAGG + Intergenic
1089642045 11:119854090-119854112 CTTTTTGAGCAGTGCTTGCAAGG + Intergenic
1094768023 12:33619817-33619839 CTTTTTTAGCAGTGTGAGAATGG + Intergenic
1094792758 12:33933405-33933427 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1095175649 12:39089087-39089109 CTTTATAAGCAGCCCGTGCAAGG + Intergenic
1095793528 12:46193083-46193105 CATTTAAAGCAGTGTGTACAGGG - Intronic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1096950376 12:55462301-55462323 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1098115946 12:67176791-67176813 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1098723096 12:73927120-73927142 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1098993629 12:77093601-77093623 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1099243204 12:80162885-80162907 CATTCTCAGCAGTGGGGGCAAGG - Intergenic
1102616898 12:114162588-114162610 CTTATTCAGCAGTGGGTTTAGGG + Intergenic
1102865879 12:116373669-116373691 CTTTTTAAGCCGTGAGGGGAAGG + Intergenic
1103605542 12:122083302-122083324 CTGTTTAAGAAGTGGGTGTTTGG + Intronic
1105286712 13:19010138-19010160 CTTTTCAAGCAATTGGTGCTGGG + Intergenic
1105981046 13:25516550-25516572 CTTTTGGGGCAGTGGCTGCATGG + Intronic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1111786469 13:92793375-92793397 CATTTAAAGCAGTGTGTGCAGGG + Intronic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1113588430 13:111481440-111481462 CTTTTGAAGCTGTGTCTGCACGG + Intergenic
1114708851 14:24756387-24756409 CATTTAAAGCAGTGTGTGGAAGG + Intergenic
1115624609 14:35177896-35177918 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1115995636 14:39193012-39193034 TTTTTTAAGTTGTGGGTGGAGGG + Intergenic
1117529206 14:56642498-56642520 CATTTAAAGCAGTGTGTGGAGGG + Intronic
1118636015 14:67749471-67749493 CTGTTTAACCAGGGGGTGCTGGG - Intronic
1119736217 14:76984482-76984504 TGCTTTAAGCAGTGGGTGGAGGG + Intergenic
1120366994 14:83583463-83583485 CTGCTTTAGCAGTGGCTGCAAGG + Intergenic
1121665971 14:95672646-95672668 CTTTTCATGCAGCAGGTGCAAGG + Intergenic
1122954989 14:105066359-105066381 CTCTTTCAGCAGTGGGGACAGGG + Intergenic
1123040811 14:105489541-105489563 CTTTTAAACCAGTGGGTGTCCGG - Intronic
1124654660 15:31498650-31498672 CATTTTAAGATGTGGCTGCAAGG + Intronic
1126164817 15:45645864-45645886 CTTTATTGGCTGTGGGTGCAGGG + Intronic
1126910040 15:53408215-53408237 CTTTTAGTGCAGTGGGTGAATGG - Intergenic
1128988733 15:72240997-72241019 CTTTTTAATCAGTGGATTAAAGG - Intergenic
1129788596 15:78325429-78325451 CTTTTGAATCAGTGGGCTCACGG + Intergenic
1130096807 15:80862201-80862223 CTTATAAATCAGTGGATGCATGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132992522 16:2804227-2804249 CTTTTGATGCACTGGGTGCTGGG + Intergenic
1139106533 16:63833705-63833727 ACTTCTAAGCAGTGGGTGTATGG - Intergenic
1143685901 17:8515442-8515464 GTTATGAAGCAGTGGGTTCAGGG - Intronic
1146400309 17:32496100-32496122 CTTTCTAAGCACTGGTTGCCCGG + Intronic
1146569355 17:33939511-33939533 CTTTTTATGCAGGGGATCCAGGG - Intronic
1152312286 17:79558606-79558628 CCTCTCAAGCAGTGAGTGCATGG - Intergenic
1152593247 17:81223718-81223740 CTTTTTAAAAAGCGGGGGCAGGG - Intergenic
1155568248 18:27161262-27161284 CTATTAAAGCAGTGTGTACAGGG - Intronic
1157086702 18:44587467-44587489 CTTTTTCTGCAGTGGCTGCCAGG + Intergenic
1158072834 18:53493978-53494000 CATTTAAAGCAGTGTGTACAGGG - Intronic
1160260387 18:77288498-77288520 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1160304055 18:77715395-77715417 CTTTTTCAGCAATGGCAGCAGGG - Intergenic
1164091186 19:21953986-21954008 CATTTTAAGCAGTGTGTAGAGGG - Intronic
1164110377 19:22151358-22151380 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
1164110990 19:22158675-22158697 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
1164554352 19:29239543-29239565 CTTTAAACCCAGTGGGTGCAGGG - Intergenic
1164864669 19:31594576-31594598 CTTATTAACCAGTGAGTCCAGGG - Intergenic
1166156461 19:40915658-40915680 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
925201175 2:1968764-1968786 CTCTTTAGGCAGAGGCTGCACGG + Intronic
928378160 2:30795090-30795112 CTTTTTAACCATGGGGTGCAGGG - Intronic
928482597 2:31697744-31697766 CTGTATAAGCTGTGGGTCCAGGG - Intergenic
928616709 2:33047265-33047287 CATTTAAAGCAGTGTGTACAGGG - Intronic
928658738 2:33479556-33479578 TTTTTTGAGCTGTGGGTGTAAGG + Intronic
929039141 2:37726127-37726149 CATTTAAAGCAGTGTGTGGAGGG + Intronic
929548726 2:42875401-42875423 CTTTGTGAGCAGTGGCTGCTGGG + Intergenic
930274436 2:49295294-49295316 CATTTTAAGTAATTGGTGCAAGG + Intergenic
930295212 2:49545567-49545589 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
930321706 2:49862857-49862879 CTCTTCAAGCATTGGATGCATGG - Intergenic
930437314 2:51361842-51361864 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
931243817 2:60476433-60476455 CTTTGTGAGCAATGGGTGCCAGG - Intronic
932316301 2:70786237-70786259 TTTTTTTGGCAGGGGGTGCAGGG + Intronic
934980498 2:98835906-98835928 CTTTCTGAGCAGTGGGTTCAGGG - Intronic
935409149 2:102740557-102740579 CTTTATAAGCAGTGCGAGAATGG + Intronic
935472183 2:103473827-103473849 CATTTAAAGCAGTGTGTACAGGG - Intergenic
937646786 2:124274577-124274599 GTTTTTAAGGACTGGGTACATGG + Intronic
937791105 2:125962835-125962857 TTTTTAAATCAGTGGTTGCATGG + Intergenic
937967510 2:127525269-127525291 GTTTTTAAGCAGTGCATGCCTGG + Intronic
939314358 2:140528696-140528718 TTTTGTAAGCAGTAGGAGCAAGG + Intronic
939555672 2:143669971-143669993 CTGTTCAAGCTGTGTGTGCAAGG + Intronic
939864477 2:147457679-147457701 GTTTTTAAACAGAGGATGCAGGG - Intergenic
940824782 2:158398617-158398639 CATTTAAAGCAGTGGGTAGAGGG + Intronic
941247895 2:163123800-163123822 CTTTTTAAGAAGTGGTTTCTAGG - Intergenic
941254408 2:163210438-163210460 CTGGTTAAGCAGTGGGAGTATGG + Intergenic
942575310 2:177356990-177357012 CCTTTTAAGGATTGGGTGCTGGG - Intronic
942958458 2:181801701-181801723 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
945116499 2:206413212-206413234 CATTTAAAGCAGTGTGTACAGGG - Intergenic
945161588 2:206897360-206897382 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
945560490 2:211333478-211333500 TTTTTTAAGCACTGGGACCAGGG + Intergenic
946294107 2:218769811-218769833 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
946767839 2:223056546-223056568 TTTTTTAAGCCATGGGTGGAAGG + Intronic
1170494351 20:16910580-16910602 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1173269133 20:41515910-41515932 CTTTTTAAGCAATGGATAGATGG + Intronic
1175071721 20:56339755-56339777 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1179172270 21:38981697-38981719 CTTGTTAGGGAGTGGGTGCTGGG - Intergenic
1180912866 22:19465105-19465127 CTTTTTAAGCAGCGTATGCCTGG - Intronic
1185196783 22:49476726-49476748 CTTTGCAACCAGTGGGTGGATGG + Intronic
949172903 3:1023471-1023493 CTTTATAAGAAGTGCCTGCAGGG - Intergenic
949244992 3:1916641-1916663 CATTTAAAGCAGTGTGTGAAGGG - Intergenic
950575427 3:13829486-13829508 CATTTTGAGCAGTGGATGCTGGG + Intronic
951084664 3:18497424-18497446 CTCTTTGAGCAGAGTGTGCAAGG + Intergenic
951985992 3:28621575-28621597 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
952251223 3:31657009-31657031 CTTTTTCAGCAGTGCTTTCATGG - Intergenic
952504824 3:33998356-33998378 CTGTTTAACCAGGGTGTGCAAGG + Intergenic
952513745 3:34082862-34082884 CATTTAAAGCAGTGTGTACAGGG - Intergenic
952587200 3:34907098-34907120 CATTTAAAGCAGTGTGTACAGGG + Intergenic
952925356 3:38315993-38316015 CTTTCCAGGCAGTGAGTGCAAGG - Intronic
953145892 3:40274335-40274357 CATTTAAAGCAGTGTGTACAGGG + Intergenic
954015071 3:47681598-47681620 CATGTTAAGTAGTGGTTGCACGG + Intronic
954235284 3:49252342-49252364 ATTTTTAAAAAGTGGGTCCAGGG - Intronic
954836224 3:53471090-53471112 CATTTAAAGCAGTGTGTACAGGG - Intergenic
955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG + Intronic
955736396 3:62042926-62042948 CTTTTTAAGATGTGGGTCAAAGG - Intronic
955993155 3:64650210-64650232 CTTTTTAACCAGATGGTGTAAGG - Intronic
956472043 3:69577504-69577526 CATTTAAAGCAGTGGGTAGACGG - Intergenic
958185203 3:90110996-90111018 CTTGTCAGACAGTGGGTGCAGGG - Intergenic
958625929 3:96624331-96624353 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
958628643 3:96658898-96658920 CTTATTAAGCATTGGGTGGAGGG + Intergenic
962691130 3:137899582-137899604 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
962699487 3:137982817-137982839 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
963984174 3:151572871-151572893 CATTTAAAGCAGTGTGTACAGGG - Intergenic
964214615 3:154265563-154265585 CATTTAAAGCAGTGGGTAGAAGG + Intergenic
964274574 3:154995902-154995924 CTTTATTAGCAGTGTGTGAATGG - Intergenic
966004018 3:174986205-174986227 CATGTTGAGCAGTGGGTGCTAGG - Intronic
966320483 3:178695961-178695983 CTTTGTTAGCAGTGTGAGCATGG - Intronic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
967516346 3:190373224-190373246 CTGTTTCAGCAGGGGTTGCAGGG + Intronic
969992220 4:11276418-11276440 GATTTTAAACAGTGGGTCCAAGG - Intergenic
970904732 4:21202616-21202638 CTTTTTAAGCAATGTGGACAAGG + Intronic
971111776 4:23592939-23592961 CTTTATTAGCAGTGGGAGAATGG + Intergenic
971219829 4:24694725-24694747 CTAATTGAGCAGTGGGTACAAGG + Intergenic
971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG + Intronic
971278561 4:25221669-25221691 CTTTATTAGCAGTGGGAGAATGG - Intronic
972808845 4:42561174-42561196 CTTTTTATCCAGCGTGTGCACGG + Intronic
972914574 4:43859968-43859990 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
973179007 4:47244834-47244856 CATTTAAAGCAGTGTGTACAGGG + Intronic
973534614 4:51868152-51868174 CTTTTGAGGCTGTGGGGGCAGGG + Intronic
975236145 4:71999038-71999060 CATTTAAAGCAGTGTGTACAGGG + Intergenic
975306041 4:72849764-72849786 CATTTAAAGCAGTGTGTACAGGG + Intergenic
975449564 4:74508321-74508343 CATTTAAAGCAGTGTGTACAGGG + Intergenic
976263349 4:83167033-83167055 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
976477684 4:85503868-85503890 CATTTAAAGCAGTGTGTACAGGG - Intronic
976760331 4:88541936-88541958 CATTTAAAGCAGTGTGTGGAGGG + Intronic
977219532 4:94322914-94322936 CATTTAAAGCAGTGTGTACAGGG - Intronic
977496451 4:97780921-97780943 CATTTAAAGCAGTGGGTAGAGGG + Intronic
978308982 4:107364611-107364633 CTTTTTTAGCAGTGTGAGAATGG + Intergenic
980584359 4:134792564-134792586 CATTTAAAGCAGTGTGTACAGGG + Intergenic
982785416 4:159531191-159531213 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
983694156 4:170508240-170508262 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
985696412 5:1343301-1343323 CTCTTCAGGCAGAGGGTGCAGGG + Intronic
986581955 5:9274821-9274843 CATTTAAAGCAGTGGGTAGAGGG + Intronic
987658691 5:20843541-20843563 CTTTTTAAGAAGTGTTTTCATGG + Intergenic
987949548 5:24657854-24657876 CATTTAAAGCAGTGTGTACAGGG - Intergenic
988770858 5:34431912-34431934 CATTTAAAGCAGTGTGTACAGGG - Intergenic
991118155 5:62978340-62978362 CTTTTTTAGCGGTGGGCTCATGG + Intergenic
991199734 5:63978048-63978070 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
991553473 5:67869120-67869142 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
992189852 5:74281140-74281162 TTTTTTAAGAAGTGGGTTCAAGG - Intergenic
994277947 5:97862265-97862287 CTTTTTAACCAGTCTCTGCATGG + Intergenic
994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG + Intergenic
995066383 5:107867866-107867888 CGTGTTTAGCAGTGGGAGCATGG - Intronic
997578380 5:135001076-135001098 CATTTAAAGCAGTGTGTACAGGG - Intronic
997733997 5:136200232-136200254 CGTTTGAAGCAGGGGGTGCTTGG - Intergenic
999488390 5:152023842-152023864 CGTTTGAAGCAGTGGGTAGAGGG - Intergenic
1004178734 6:13363317-13363339 CTCTGTAAGCAGAGTGTGCAAGG + Exonic
1004844210 6:19621367-19621389 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1008872790 6:56291492-56291514 CTTTTGCAGTAGTGGGTGCCAGG - Intronic
1008958161 6:57238553-57238575 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1009508606 6:64518952-64518974 CTTTTTTAGCAGTGTGAGAACGG + Intronic
1010463546 6:76140933-76140955 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1010512243 6:76735218-76735240 CATTTAAAGCAGTGTGTACAGGG - Intergenic
1011529755 6:88308875-88308897 TTTTTTAATCAGTGTTTGCATGG + Intergenic
1011878868 6:91997827-91997849 CTTTTAAAGCAGTGTGAGTAGGG + Intergenic
1013147104 6:107404448-107404470 CTTTATTAGCAGTGGGAGAACGG - Intronic
1013481193 6:110554197-110554219 CTTTGAAAGCAGTGAGTGCCTGG + Intergenic
1014128209 6:117801833-117801855 CATTTAAAGCAGTGTGTACAGGG - Intergenic
1014184437 6:118419116-118419138 CTTTTTGAGCTGTGTATGCATGG + Intergenic
1014890678 6:126840528-126840550 CATTTAAAGCAGTGGGTATAGGG + Intergenic
1014907388 6:127046236-127046258 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1014986134 6:128012692-128012714 ATTTTTAAGTAGTGGGAGCAAGG - Intronic
1016921713 6:149301337-149301359 CCAGTTAAGCAGTGGGTGCTTGG + Intronic
1017553467 6:155537247-155537269 CTTTTAAAGCAGTAGCTCCACGG + Intergenic
1020370295 7:7424702-7424724 CTTTTGAGAGAGTGGGTGCAGGG - Intronic
1021961748 7:25879890-25879912 ATTATTAAGCTGTGGGTGCAAGG - Intergenic
1022501616 7:30885586-30885608 CTTTTTATTCAGTAGGTCCAGGG + Intronic
1025227476 7:57177878-57177900 CTTTGTCTGCAGTGGGTGAATGG - Intergenic
1026651966 7:72223508-72223530 CTTTTTAAGCAGTGGCTGCTGGG - Intronic
1027466345 7:78519332-78519354 ATTTTTGAACAGTGGGTGAAGGG + Intronic
1028055043 7:86230496-86230518 CATTTCAAGCAGTGTGTACAGGG + Intergenic
1028159331 7:87467885-87467907 CATTTAAAGCAGTGGGTAGAGGG + Intronic
1029006262 7:97213190-97213212 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
1031175315 7:118341301-118341323 CTTTATTAGCAGTGTGAGCATGG + Intergenic
1031527330 7:122837268-122837290 CATTTAAAGCAGTGGGTAGAGGG + Intronic
1031590995 7:123592436-123592458 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1033095917 7:138430594-138430616 CTTTATTAGCAGTGGGAGAACGG + Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033902518 7:146160182-146160204 CATTTAAAGCAGTGTGTGCAGGG + Intronic
1034110404 7:148531955-148531977 CTTTTAAAGCAGTGTGTAGAAGG + Intergenic
1034119959 7:148618182-148618204 CTTTATAAGCAGTGTGAGAATGG - Intergenic
1034583082 7:152063613-152063635 CATTTAAAGCAGTGGGTAGAGGG - Intronic
1035237786 7:157509917-157509939 ATTTTTAAGCAGTGTGTAGAGGG + Intergenic
1035341365 7:158164702-158164724 CTTTTTAAGCTGTGGGAGATGGG + Intronic
1035554557 8:556510-556532 CTTATTCAGCAGTGGGCGCATGG + Intergenic
1037394180 8:18424557-18424579 ATTTTCAAACAGTGGGTGCAAGG + Intergenic
1037985720 8:23289395-23289417 CTGTTTAAGTAGTGGGTGTGTGG + Intronic
1038873042 8:31517284-31517306 CATTTAAAGCAGTGTGTACAGGG - Intergenic
1039037911 8:33379242-33379264 CTTTATAAGCAGTGGGAAAATGG + Intronic
1039432945 8:37539777-37539799 GGTTTGAAGCAGTGGCTGCAAGG - Intergenic
1040411057 8:47154700-47154722 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1040922392 8:52636821-52636843 CTTTTTCAGCAAATGGTGCAGGG - Intronic
1042534630 8:69846262-69846284 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1042536487 8:69863810-69863832 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1042541389 8:69910518-69910540 CATTTAAAGCAGTGTGTACAAGG + Intergenic
1044587131 8:93878411-93878433 CTTTTTAATCACCTGGTGCAGGG + Intronic
1044761517 8:95522544-95522566 CCATTTAAGAGGTGGGTGCAAGG - Intergenic
1046604408 8:116354822-116354844 CTTTTTAAGTCGTGGGTATATGG + Intergenic
1046901059 8:119523999-119524021 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1047023961 8:120807433-120807455 CATTTTAAGGAGTAGGGGCAGGG - Intronic
1047706750 8:127506863-127506885 CACTTTAAGCAGTGGGAGTAGGG + Intergenic
1047931815 8:129735646-129735668 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1048381171 8:133866341-133866363 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1048466673 8:134670592-134670614 CATTTAAAGCAGTGTGTACAGGG + Intronic
1049860752 8:144896890-144896912 CTTTGTAACCAGTGGGTGGGAGG - Intronic
1051492380 9:17680781-17680803 CATTTAAAGCAGTGTGTACAGGG - Intronic
1052691281 9:31819878-31819900 CTTTTTAAGAGGTGGGAACAGGG + Intergenic
1055338426 9:75256846-75256868 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1055369084 9:75577556-75577578 CTCTTTAAGCAGTGTGGGCTGGG - Intergenic
1055713356 9:79089155-79089177 CTTTTTTAGCAATGGATGGAGGG + Intergenic
1055740599 9:79384020-79384042 CTTTTAAAGCATTGAGAGCAAGG - Intergenic
1058772662 9:108251667-108251689 CTTTTTAACAAGTGGGTGCTAGG - Intergenic
1203688460 Un_GL000214v1:18970-18992 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1203647815 Un_KI270751v1:85083-85105 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1186950982 X:14624502-14624524 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1188021639 X:25165090-25165112 CTTTTTAGGCTGTGGGACCAAGG + Intergenic
1188380137 X:29481551-29481573 CTTTTGAAGCAGGCTGTGCAAGG - Intronic
1188559799 X:31454647-31454669 CTTTTGATTCAGTGGGTGTAAGG + Intronic
1189970090 X:46409441-46409463 ATTTTTAAGGAGTGTGTGTAGGG - Intergenic
1190929933 X:54939233-54939255 CATTTAAAGCAGTGTGTACAGGG + Intronic
1192007923 X:67237067-67237089 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1192069523 X:67922496-67922518 CATTCTCAGCAGTGGCTGCATGG + Intergenic
1192695017 X:73404343-73404365 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1193655246 X:84189513-84189535 CTTCGAAAGTAGTGGGTGCATGG + Intergenic
1195218325 X:102721926-102721948 CTTGGTACCCAGTGGGTGCATGG - Intronic
1195605770 X:106803731-106803753 CTTTTTAAGAATTGGGGTCAGGG - Intronic
1198039298 X:132834071-132834093 CTTTTTAGGGAGTGGGAGGATGG - Intronic
1198166186 X:134059784-134059806 CATTTAAAGCAGTGTGTACAGGG - Intergenic
1198168649 X:134082445-134082467 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1198209857 X:134506775-134506797 CTGGTTAAGAAATGGGTGCATGG - Intronic
1198955258 X:142122289-142122311 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1199292620 X:146121858-146121880 CATTTAAAGCAGTGTGTACAGGG + Intergenic
1201684543 Y:16686172-16686194 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1201713345 Y:17016205-17016227 GTTTTCAAGTAGTGAGTGCAGGG + Intergenic
1201796065 Y:17897623-17897645 CATTCAAAGCAGTGGGTACAGGG + Intergenic
1201805490 Y:18008362-18008384 CATTCAAAGCAGTGGGTACAGGG - Intergenic
1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG + Intergenic
1201884714 Y:18868948-18868970 CATTTTAGGCACAGGGTGCATGG - Intergenic
1201919296 Y:19217103-19217125 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1202087031 Y:21149105-21149127 CTTTATAAGATTTGGGTGCACGG - Intergenic
1202357470 Y:24066689-24066711 CATTCAAAGCAGTGGGTACAGGG + Intergenic
1202513308 Y:25603424-25603446 CATTCAAAGCAGTGGGTACAGGG - Intergenic