ID: 971242945

View in Genome Browser
Species Human (GRCh38)
Location 4:24905132-24905154
Sequence GGCCACGGCGGTGGATCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1065
Summary {0: 1, 1: 6, 2: 43, 3: 181, 4: 834}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971242945_971242948 -9 Left 971242945 4:24905132-24905154 CCTCATGATCCACCGCCGTGGCC 0: 1
1: 6
2: 43
3: 181
4: 834
Right 971242948 4:24905146-24905168 GCCGTGGCCTCCCAAAGTGCTGG 0: 263
1: 54626
2: 167311
3: 218885
4: 176337
971242945_971242955 19 Left 971242945 4:24905132-24905154 CCTCATGATCCACCGCCGTGGCC 0: 1
1: 6
2: 43
3: 181
4: 834
Right 971242955 4:24905174-24905196 CAGGAGTGAGCCACCGCACCCGG 0: 316
1: 13389
2: 71853
3: 125095
4: 154761
971242945_971242952 0 Left 971242945 4:24905132-24905154 CCTCATGATCCACCGCCGTGGCC 0: 1
1: 6
2: 43
3: 181
4: 834
Right 971242952 4:24905155-24905177 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
971242945_971242950 -8 Left 971242945 4:24905132-24905154 CCTCATGATCCACCGCCGTGGCC 0: 1
1: 6
2: 43
3: 181
4: 834
Right 971242950 4:24905147-24905169 CCGTGGCCTCCCAAAGTGCTGGG 0: 468
1: 87323
2: 212358
3: 238195
4: 151717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971242945 Original CRISPR GGCCACGGCGGTGGATCATG AGG (reversed) Intronic
900010142 1:99330-99352 GCCAACGTGGGTGGATCATGAGG - Intergenic
900026249 1:275893-275915 GCCAACGTGGGTGGATCATGAGG - Intergenic
900036035 1:409729-409751 GCCAACGTGGGTGGATCATGAGG - Intergenic
900057659 1:645481-645503 GCCAACGTGGGTGGATCATGAGG - Intergenic
900693595 1:3996376-3996398 GGCCATGGAGGTGGATGAAGTGG + Intergenic
900801204 1:4738193-4738215 GGCCACGGCCATGCATGATGAGG + Intronic
901360776 1:8697621-8697643 GGCCGAGGCGGCGGATCACGAGG - Intronic
901620955 1:10586873-10586895 GGCCGAGGCGGTGGATCATGAGG - Intronic
901683894 1:10932865-10932887 GCCCAGGCGGGTGGATCATGAGG - Intergenic
902452071 1:16502719-16502741 GGCCAAGGCGGTGGATCACGAGG + Intergenic
902491702 1:16787049-16787071 GCCAAGGCCGGTGGATCATGAGG - Intronic
902855855 1:19204234-19204256 GGCCAAGGCAGTGGATCACGAGG - Intronic
903047860 1:20577794-20577816 GGCCGAGGCGGTGGATCACGAGG - Intergenic
903111289 1:21136282-21136304 GCCCAGGCAGGTGGATCATGAGG + Intronic
903247690 1:22028086-22028108 GGCAAGGGCGGTGGATCATGAGG + Intergenic
903368308 1:22818360-22818382 AGCCAGGGCGGTGGTTCATGGGG - Intronic
903388455 1:22945565-22945587 GGCCGAGGCGGGTGATCATGAGG - Intergenic
903417714 1:23195669-23195691 GGCCGAGGCAGCGGATCATGAGG - Intergenic
903605664 1:24573353-24573375 GGCCAAGGTCGTGGATCACGAGG + Intronic
904095724 1:27975717-27975739 GGCCAAGACGGGCGATCATGAGG - Intronic
904115027 1:28155441-28155463 GGCCGAGGTGGCGGATCATGAGG - Intronic
904162883 1:28534413-28534435 GGCCAAGGCGGGCGATCACGAGG - Intronic
904180978 1:28666527-28666549 GGCCAAGGCAGCAGATCATGAGG + Intergenic
904181184 1:28667819-28667841 GCCCAGGCGGGTGGATCATGAGG + Intergenic
904224683 1:29006469-29006491 GCCCAGGCGGGTGGATCATGAGG - Intronic
904245877 1:29187800-29187822 GCCCAGGTGGGTGGATCATGAGG + Intergenic
904250711 1:29222329-29222351 GCCCAGGCGGGTGGATCATGAGG - Intronic
904635082 1:31873742-31873764 GCCGAGGTCGGTGGATCATGAGG + Intergenic
905116163 1:35642600-35642622 GGGCACGGGGGCGGATCAAGAGG + Intergenic
905299293 1:36975526-36975548 GGCCAAGGCGGGAGATCACGAGG - Intronic
905363454 1:37435867-37435889 GGCCACGGCGGGTGATCGGGTGG - Intergenic
905582511 1:39093016-39093038 GCCCAGGCGGGTGGATCATGAGG - Intronic
905652253 1:39664379-39664401 GGCCGAGGCGGGGGATCACGAGG - Intronic
905816399 1:40954281-40954303 GCCGACGCGGGTGGATCATGAGG + Intergenic
906985471 1:50678545-50678567 GGCCAAGGTGGTGGATCACGAGG + Intronic
907191491 1:52652729-52652751 GCCCAGGAGGGTGGATCATGAGG + Intronic
908104529 1:60827784-60827806 GCCAAGGGTGGTGGATCATGAGG - Intergenic
908376823 1:63551356-63551378 GCCCAGGCAGGTGGATCATGAGG + Intronic
908465558 1:64390164-64390186 GGCCAAGGTGGCGGATCACGAGG - Intergenic
908482583 1:64556882-64556904 GGCAAGGCGGGTGGATCATGAGG + Intronic
909061047 1:70879858-70879880 GGCCGAGTGGGTGGATCATGAGG + Intronic
910266316 1:85341578-85341600 GGCCGAGGCGGTGGATCACGAGG + Intronic
910271723 1:85402673-85402695 GGCCGAGGCGGTGGATCACGAGG + Intronic
910406120 1:86892164-86892186 TGCCGGGGGGGTGGATCATGCGG - Intronic
910420693 1:87058824-87058846 GGCCGAGGCGGGGAATCATGAGG + Intronic
910504447 1:87933876-87933898 GGCCAAGGCAGCGGATCATGAGG - Intergenic
910876151 1:91880363-91880385 GGCCAAGACGGCGGATCACGAGG + Intronic
911608237 1:99932510-99932532 GGCCAAGGCGGTGGATCCTGAGG - Intergenic
911996042 1:104768085-104768107 GGCCGAGGTGGCGGATCATGAGG + Intergenic
912080211 1:105926808-105926830 GCCCAGGCGGGTGGATCATGAGG - Intergenic
912085921 1:106003954-106003976 GCCGACGTGGGTGGATCATGAGG + Intergenic
912735033 1:112142987-112143009 GGCCACAGTGGTGGATAATGAGG - Intergenic
912817931 1:112844408-112844430 GCCCAGGTGGGTGGATCATGAGG + Intergenic
912990461 1:114481356-114481378 AGCCAAGGTGGTGGATCACGAGG + Intronic
913236073 1:116784493-116784515 GCCGAGGGGGGTGGATCATGAGG + Intergenic
913321971 1:117595085-117595107 GGGCACGGGGGTGGATCAAAGGG - Intergenic
913428584 1:118763011-118763033 GCCAAGGGAGGTGGATCATGAGG + Intergenic
914378072 1:147091012-147091034 GGCCGAGACGGCGGATCATGAGG - Intergenic
914644910 1:149643959-149643981 GCCCAAGAGGGTGGATCATGAGG - Intergenic
914748478 1:150516009-150516031 GGCCGAGGCGGTGGATCACGAGG + Intergenic
914833906 1:151191443-151191465 GCCGAAGGGGGTGGATCATGAGG + Intronic
914903432 1:151725040-151725062 GCCCAGGCAGGTGGATCATGAGG - Intronic
915316576 1:155032225-155032247 GGCTGAGGCGGTGGATCAGGAGG - Intronic
915368954 1:155331788-155331810 GCCAAGGGGGGTGGATCATGAGG + Intergenic
915692484 1:157703701-157703723 GGCCGAGTGGGTGGATCATGAGG - Intergenic
915818615 1:158996851-158996873 GGCCAAGGCGGGTGATCACGAGG - Intergenic
916225233 1:162483285-162483307 GGCCGAGGAGGTGGATCACGAGG - Intergenic
916391089 1:164331607-164331629 GGCCGAGGCGGTGGATCACGAGG + Intergenic
917204980 1:172562568-172562590 GGCCAAGGCGGGTGATCACGAGG - Intronic
917233212 1:172860819-172860841 AGCCAAGGCGGTGGATCACGAGG + Intergenic
917274532 1:173318204-173318226 GCCAAGGGGGGTGGATCATGAGG + Intergenic
917460895 1:175228166-175228188 GGCCAAGTGGGCGGATCATGAGG - Intergenic
918288074 1:183078345-183078367 GGCCGAGGCGGTGGATCACGAGG + Intronic
918308106 1:183265497-183265519 GCCGAGGGAGGTGGATCATGAGG - Intronic
918326881 1:183418353-183418375 GGCTCCGGCGGTGGATGCTGTGG + Exonic
918880995 1:190120735-190120757 GGCCGAGGCGGTGGATCACGAGG - Intronic
918882852 1:190148357-190148379 GGCCGAGGCGGCGGATCAAGAGG + Intronic
918907272 1:190513243-190513265 GCCAACGTGGGTGGATCATGAGG - Intergenic
919288823 1:195601704-195601726 GCCCAGGTGGGTGGATCATGAGG - Intergenic
919397670 1:197070703-197070725 GCCGAGGGAGGTGGATCATGAGG + Intergenic
919424794 1:197416940-197416962 GCCCAGGCGGGTGGATCATGAGG - Intronic
919642923 1:200063256-200063278 GCCGAGGGAGGTGGATCATGAGG - Intronic
919906822 1:202084233-202084255 GCCAAGGCCGGTGGATCATGAGG + Intergenic
919995244 1:202742106-202742128 GGCTGAGGAGGTGGATCATGAGG - Intronic
920103260 1:203531710-203531732 GGCCGAGGCGGTGGATCATGAGG - Intergenic
920167979 1:204049609-204049631 GCCCAGGCAGGTGGATCATGAGG - Intergenic
920232766 1:204481489-204481511 GCCCAGGCAGGTGGATCATGAGG - Intronic
921046289 1:211480129-211480151 GGGGACGGGGGTGGGTCATGGGG - Intronic
921350775 1:214232210-214232232 GACCAGGCGGGTGGATCATGAGG + Intergenic
921865175 1:220081167-220081189 GGCCAAGGGGGGGGATCACGAGG - Intronic
922319347 1:224471822-224471844 GCCGAGGCCGGTGGATCATGAGG - Intronic
922377886 1:224987858-224987880 GCCAAGGGAGGTGGATCATGAGG - Intronic
922678021 1:227564966-227564988 GGCCAAGGCGGGGGATCACGAGG - Intronic
922850460 1:228729126-228729148 GCCCAGGCAGGTGGATCATGAGG - Intergenic
923215493 1:231844690-231844712 GCCGACGGGGGTGGATCACGAGG + Intronic
923220502 1:231888508-231888530 GCCGAGGGGGGTGGATCATGAGG + Intronic
923490698 1:234481474-234481496 GCCGAGGCCGGTGGATCATGAGG + Intergenic
923528745 1:234795490-234795512 GCCAAGGCCGGTGGATCATGAGG + Intergenic
923611281 1:235496776-235496798 GGCCGAGGCGGTGGATCACAAGG - Intronic
923937445 1:238778961-238778983 GGCCAAGGCGGGGGATCACGAGG - Intergenic
924060459 1:240168976-240168998 GGCCAGGCAGGTGGATCATGAGG + Intronic
924356212 1:243178950-243178972 GGCCAAGGCGGGTGATCACGAGG - Intronic
924361863 1:243249846-243249868 GGCCTAGGCAGTGGACCATGAGG + Intronic
924707562 1:246511854-246511876 GGCCAGAGCAGAGGATCATGGGG + Intergenic
1062761581 10:26460-26482 GGCCGAGCCGGTGGATCACGAGG - Intergenic
1063547261 10:6993271-6993293 GCCAACGTGGGTGGATCATGAGG + Intergenic
1063815550 10:9767499-9767521 GGCCAAGGCAGTGGATCACGAGG + Intergenic
1064009548 10:11724802-11724824 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1064210831 10:13359428-13359450 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1064307026 10:14176705-14176727 GGCCGAGGGGGTGGATCGTGAGG - Intronic
1064351335 10:14580123-14580145 GCCCAGGTGGGTGGATCATGAGG + Intronic
1064650984 10:17508928-17508950 GGCCAAGGGGGTGGATCACAAGG + Intergenic
1065386074 10:25134361-25134383 GGCCAGGCAGGTGGATCACGAGG - Intergenic
1065414478 10:25469548-25469570 GGCCAAGTGGGTGGATCATGAGG + Intronic
1065706364 10:28474826-28474848 GGCCGAGGCGGCGGATCACGAGG + Intergenic
1066652375 10:37669157-37669179 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1066675407 10:37882058-37882080 GCCCAGGAGGGTGGATCATGAGG - Intergenic
1066679271 10:37920902-37920924 GGCCAAGTGGGTGGATCACGAGG + Intergenic
1066689676 10:38013689-38013711 GGCCAAGGTGGGGGATCACGAGG - Intronic
1066698216 10:38097343-38097365 GGCGAGGTGGGTGGATCATGAGG + Intronic
1066748709 10:38630706-38630728 GGCCAAGGCAGTGGATCATGAGG + Intergenic
1066967964 10:42287076-42287098 GGCCAAGGCAGTGGATCATGAGG - Intergenic
1067852747 10:49764988-49765010 GGCCAAGGTGGGGGATGATGAGG - Intergenic
1068186068 10:53588138-53588160 GCCAACGTGGGTGGATCATGAGG - Intergenic
1068329026 10:55537666-55537688 GCCGACGGGGGTGGATCATGAGG - Intronic
1068884770 10:62087063-62087085 GGCCGAGGCGGTGGATCACGAGG + Intronic
1068984242 10:63092470-63092492 GGCCAAGGTGGCGGATCACGAGG - Intergenic
1068989121 10:63133261-63133283 GGCCTCGGCGGTGGCGCAGGGGG + Intronic
1069033091 10:63618479-63618501 GCCCAGGCGGGTGGATCATGAGG - Intronic
1069362646 10:67660695-67660717 GGCCGAGGCGGTGGATCATGAGG + Intronic
1069495087 10:68896693-68896715 GGCCGAGGTGGCGGATCATGAGG - Intergenic
1070314935 10:75300936-75300958 ACCCAGGGGGGTGGATCATGAGG - Intergenic
1070372072 10:75792091-75792113 GGCCGAGGCGGGGGATCACGAGG - Intronic
1070394100 10:75996964-75996986 GGCGAGGCGGGTGGATCATGAGG - Intronic
1070686234 10:78484769-78484791 GGCCAAGCGGGTGGATCATGAGG - Intergenic
1070898762 10:80009205-80009227 GGCTGAGGCGGCGGATCATGAGG + Intergenic
1070903878 10:80054723-80054745 GGCCAAGGGGGCGGATCACGAGG + Intergenic
1071247135 10:83776997-83777019 GGCCAAGGGGGAGGATCACGAGG + Intergenic
1071706567 10:88005870-88005892 GGCCGAGGCGGTGGATCACAAGG - Intergenic
1072338218 10:94419438-94419460 GCCCAGGTGGGTGGATCATGAGG + Intronic
1072568249 10:96635971-96635993 GCCGAGGGGGGTGGATCATGAGG + Intronic
1072592290 10:96837488-96837510 GGCCGAGGTGGTGGATCACGAGG - Intronic
1073033109 10:100543804-100543826 GGCCAAGGCGGGGGATCATGAGG - Intronic
1073699939 10:105915653-105915675 GCCCAAGCCGGTGGATCACGAGG - Intergenic
1073939732 10:108682367-108682389 GACCATGGGGCTGGATCATGAGG - Intergenic
1074203079 10:111257111-111257133 GGCCAAGGCGGTGGATCACCTGG + Intergenic
1074770138 10:116728173-116728195 GCCCAGGTGGGTGGATCATGAGG - Intronic
1075213516 10:120511856-120511878 GGCCGAGGTGGCGGATCATGAGG + Intronic
1075313262 10:121432176-121432198 GCCCAGGCCGGGGGATCATGAGG - Intergenic
1076251775 10:128990209-128990231 GGCGAGGCGGGTGGATCATGAGG + Intergenic
1076341186 10:129745999-129746021 GGCCAAGGGGGCGGATCATGAGG + Intronic
1077517986 11:3013614-3013636 GGCGAAGTGGGTGGATCATGAGG + Intronic
1077597011 11:3541844-3541866 GCCAACGCGGGTGGATCATGAGG + Intergenic
1077884027 11:6372593-6372615 GCCGATGCCGGTGGATCATGAGG - Intergenic
1077938050 11:6811450-6811472 GGCCGAGGCGGCGGATCACGAGG - Intergenic
1078232255 11:9454214-9454236 GCCCAGGTGGGTGGATCATGAGG - Intergenic
1078251275 11:9618615-9618637 GGCCAAGTGGGTGGATCATGAGG + Intergenic
1078650049 11:13182051-13182073 GGCCAAGGCGATGGATCACAAGG - Intergenic
1079172419 11:18108939-18108961 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1079184920 11:18228023-18228045 GGCCGAGGCAGTGGATCACGAGG + Intronic
1079228342 11:18627642-18627664 GCCGAGGGGGGTGGATCATGAGG + Intronic
1079480677 11:20876528-20876550 GGCCGAGGCGGTGGATCTCGAGG + Intronic
1079845848 11:25466720-25466742 GCCAAGGGAGGTGGATCATGAGG + Intergenic
1079925346 11:26486126-26486148 GGCCAAGGCAGGTGATCATGAGG + Intronic
1080048312 11:27832996-27833018 GTCAAGGTCGGTGGATCATGAGG + Intergenic
1080162292 11:29191576-29191598 GCCAACGGGGGTGGATCACGAGG - Intergenic
1080671478 11:34383403-34383425 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1081515840 11:43828374-43828396 GGCCGAGGCGGCGGATCACGAGG - Intronic
1081930833 11:46869871-46869893 GGCCAAGGTGGGCGATCATGAGG + Intronic
1082062506 11:47872730-47872752 GGCCGAGGCGGTGGATCATGAGG + Intergenic
1082220508 11:49629846-49629868 GCCAAGGGAGGTGGATCATGAGG - Intergenic
1083230788 11:61317345-61317367 GGCCAAGGTGGCGGATCACGAGG - Intronic
1083445212 11:62703882-62703904 GGCCAAGGGGGTGGATCACGAGG + Intronic
1083634369 11:64112277-64112299 GCCCAGGGAGGTGGATCACGAGG + Intronic
1083791031 11:64986002-64986024 GGCCAAGGCAGGCGATCATGAGG - Intergenic
1083910085 11:65702394-65702416 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1084037578 11:66521981-66522003 GCCAACGTGGGTGGATCATGAGG + Intronic
1084152688 11:67298294-67298316 GCCAAGGGGGGTGGATCATGAGG - Intronic
1084199955 11:67549923-67549945 GGCCGAGGCGGTGGATCACAAGG - Intergenic
1084252935 11:67915794-67915816 GCCAACGCGGGTGGATCATGAGG + Intergenic
1085591699 11:77768393-77768415 GGCCGAGGCGGGAGATCATGAGG - Intronic
1085879099 11:80444479-80444501 GCCTACGTCAGTGGATCATGAGG - Intergenic
1086311200 11:85537880-85537902 GCCCAGGTGGGTGGATCATGAGG + Intronic
1086689601 11:89774232-89774254 GCCCACGAGGGTGGATCACGAGG - Intergenic
1086716255 11:90065720-90065742 GCCCACGAGGGTGGATCACGAGG + Intergenic
1087142774 11:94781600-94781622 GGCCGAGGTGGTGGATCACGAGG + Intronic
1087443918 11:98221950-98221972 GGCCCAGGCGGTGGATCACGAGG - Intergenic
1087447971 11:98279473-98279495 GGCTAAGGCGGTGCATCAGGAGG + Intergenic
1087625154 11:100587428-100587450 GGCCGAGAAGGTGGATCATGAGG - Intergenic
1088414914 11:109578130-109578152 GGCCAAGGGGGCGGATCACGAGG + Intergenic
1089434998 11:118457503-118457525 GCCAACGCAGGTGGATCATGAGG - Intronic
1089837403 11:121383247-121383269 GGCCCTGGAGGTGGATCATCAGG - Intergenic
1089837803 11:121386734-121386756 GGCCGAGGCGGGTGATCATGAGG + Intergenic
1090533762 11:127618431-127618453 GGCCGAGGTGGTGGATCATGAGG - Intergenic
1090598729 11:128347420-128347442 GGCCAGGGCGGCGGATCACGAGG - Intergenic
1091617865 12:2063382-2063404 GGCCAAGCGGGTGGATCAAGAGG - Intronic
1092350980 12:7755538-7755560 GCCGACGCGGGTGGATCATGAGG - Intergenic
1092575905 12:9782490-9782512 GGCCAAGGCAGGCGATCATGAGG - Intergenic
1093868979 12:24263291-24263313 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1094242673 12:28247244-28247266 GCCGAGGCCGGTGGATCATGAGG + Intronic
1095196573 12:39325575-39325597 GGCCAAGGCGGATGATCAGGAGG - Intronic
1095218272 12:39576391-39576413 GGCGAGGCGGGTGGATCATGAGG - Intronic
1095385774 12:41647780-41647802 GGCCAAGGTGGGCGATCATGAGG + Intergenic
1095484932 12:42674921-42674943 GCCGACGTGGGTGGATCATGAGG + Intergenic
1096259949 12:50084276-50084298 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1096819017 12:54219527-54219549 GGCCGAGGCGGCGGATCATGTGG + Intergenic
1097025979 12:56055821-56055843 GGCCAAGGCAGTAGATCATGAGG + Intergenic
1097061810 12:56290443-56290465 GGCCGAGGTGGTGGATCACGAGG - Intronic
1097470843 12:59989078-59989100 GGCCAAGGTGGTGGATCACTTGG - Intergenic
1097922100 12:65086906-65086928 GGCTGAGGCAGTGGATCATGAGG + Intronic
1098030578 12:66249397-66249419 GGCCAGGCAGGCGGATCATGAGG - Exonic
1098195395 12:67995186-67995208 GGCCAAGGTGGGAGATCATGAGG + Intergenic
1098265108 12:68710420-68710442 GGCCAAGGTGGGGGATCACGAGG + Intronic
1098402903 12:70092608-70092630 GGCCGAGGCGGGGGATCATGTGG + Intergenic
1098438288 12:70492056-70492078 GGCCGGGTGGGTGGATCATGAGG - Intergenic
1098439408 12:70502080-70502102 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1098515351 12:71369508-71369530 GTCCAGGTGGGTGGATCATGAGG - Intronic
1098601087 12:72332371-72332393 GCCCAGGTGGGTGGATCATGAGG - Intronic
1099440784 12:82697109-82697131 GCCGAAGGAGGTGGATCATGAGG + Intronic
1099798860 12:87432180-87432202 GGCCGAGGCGGTGGATCACAAGG + Intergenic
1101618349 12:106359562-106359584 GGCCGAGGCGGTGGATCACGAGG - Intronic
1102092386 12:110202685-110202707 GGCCAGGTGGGCGGATCATGAGG - Intronic
1102126329 12:110484191-110484213 GGCTGAGGCGGAGGATCATGAGG + Intronic
1102270040 12:111526121-111526143 GCCCAGGCAGGTGGATCATGAGG + Intronic
1102288567 12:111680187-111680209 GGCCGAGGCGGGGGATCACGAGG - Intronic
1102366932 12:112345659-112345681 GGCCAGGCCGGTGGCTCACGAGG + Intronic
1103001849 12:117390814-117390836 GTCCGAGGCAGTGGATCATGAGG - Intronic
1103478424 12:121235225-121235247 GGCTGAGGCGGTGGATCATGAGG - Intergenic
1103659576 12:122502845-122502867 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1103788295 12:123450172-123450194 GGCCAAGGCGGGGTATCATGAGG + Intergenic
1103801641 12:123541739-123541761 GCCCAGGGGGGTGGATCACGAGG + Intergenic
1103988581 12:124783532-124783554 GGCCAAGGCGGCAGATCATGAGG + Intronic
1104027164 12:125036296-125036318 GGCCAAGGCGGGGGATCAGAAGG - Intergenic
1104234408 12:126919231-126919253 GGCCAAGGCAGGCGATCATGAGG + Intergenic
1104321061 12:127751278-127751300 GGCCAAGGTGGTGAATCACGAGG - Intergenic
1104370122 12:128216954-128216976 GGCAAGGTGGGTGGATCATGAGG + Intergenic
1104796176 12:131520910-131520932 GGCCAAGGCGGTGGATCACGAGG + Intergenic
1104865551 12:131951148-131951170 GGCCAAGGGGGCGGATCACGAGG - Intronic
1105006278 12:132722815-132722837 GCCCAGGCAGGTGGATCATGAGG + Intergenic
1105562598 13:21508357-21508379 GGCCGAGGTGGTGGATCACGAGG - Intronic
1106232856 13:27834761-27834783 GCCGAGGGGGGTGGATCATGAGG - Intergenic
1106521604 13:30503100-30503122 GGCCGAGGCGAGGGATCATGAGG + Intronic
1106702500 13:32245180-32245202 GGCCGAGGCGGTGGATCACGAGG - Intronic
1107586064 13:41849652-41849674 GCCGAGGCCGGTGGATCATGAGG + Intronic
1108389038 13:49929727-49929749 GGCCGAGGGGGTGGATCACGAGG - Intronic
1108646274 13:52432115-52432137 GGCCGCGGCGGCGGATCACGAGG + Intronic
1109019075 13:57061841-57061863 GGCCAGGTGGGTGGATCATGAGG - Intergenic
1109252094 13:60031974-60031996 GGCCAAGGCGGTGGATCATGAGG - Intronic
1109319767 13:60795984-60796006 GGCCGAGGCGGCGGATCACGAGG - Intergenic
1110882231 13:80586222-80586244 GGTCGAGGCGGTGGATCACGAGG - Intergenic
1111108261 13:83673969-83673991 GCCCAGGCAGGTGGATCATGAGG - Intergenic
1111117092 13:83793460-83793482 GGCGAGGCTGGTGGATCATGAGG - Intergenic
1111493537 13:89017579-89017601 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1112014531 13:95320586-95320608 GGCCAAGGGGGCAGATCATGAGG + Intergenic
1112073535 13:95882140-95882162 GCCAACGTGGGTGGATCATGAGG - Intronic
1112260226 13:97871030-97871052 GGCTGAGGCGGCGGATCATGAGG - Intergenic
1112520668 13:100092148-100092170 GGCCAAGGCAGTGGATCAAGAGG - Intronic
1112678491 13:101733360-101733382 GGCCAAGGCAGGCGATCATGAGG + Intronic
1113085187 13:106562755-106562777 GCCCAGGCAGGTGGATCATGAGG + Intronic
1113125721 13:106976550-106976572 GCCGACGTGGGTGGATCATGAGG - Intergenic
1113251403 13:108457277-108457299 GATCATGGGGGTGGATCATGGGG + Intergenic
1113627762 13:111858890-111858912 GGCCAAGCAGGTGGATCATGAGG + Intergenic
1113827704 13:113269314-113269336 GGCCGAGGCGGCGGATCACGAGG + Intergenic
1114308948 14:21448795-21448817 GGCGAGGCGGGTGGATCATGAGG - Intronic
1114461943 14:22892041-22892063 GCCAAGGCCGGTGGATCATGAGG + Intergenic
1114639934 14:24212932-24212954 GCCGACGTGGGTGGATCATGAGG - Intronic
1114994454 14:28330886-28330908 GCCGAGGCCGGTGGATCATGAGG + Intergenic
1115026291 14:28750728-28750750 GGCCGAGGGGGTGGATCACGAGG + Intergenic
1115382039 14:32750967-32750989 GGCCAAGGGGGTGGATCACGAGG - Intronic
1115551555 14:34509522-34509544 GCCGACGGGGGTGGATCACGAGG + Intergenic
1115554633 14:34535069-34535091 GGCCGAGGCAGTGGATCACGAGG - Intronic
1115793523 14:36906736-36906758 GGCTGAGGGGGTGGATCATGAGG - Intronic
1116216516 14:42024255-42024277 GCCAACGTGGGTGGATCATGAGG - Intergenic
1116576122 14:46577937-46577959 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1116850691 14:49906157-49906179 GGCCAAGGGGGTGGATCACGAGG - Intergenic
1116980582 14:51166008-51166030 GGCAAGGCGGGTGGATCATGAGG - Intergenic
1117028488 14:51646082-51646104 GCCCAGGCAGGTGGATCATGAGG + Intronic
1117145903 14:52836642-52836664 GGCCGAGGCGGCGGATCACGAGG + Intergenic
1117147493 14:52849784-52849806 GGCGAGGCAGGTGGATCATGAGG - Intergenic
1117219436 14:53587494-53587516 GGCCAAGGAGGTGGTCCATGTGG + Intergenic
1117710261 14:58521206-58521228 GGCCACTGTGTTGGATGATGAGG - Intronic
1117968229 14:61227357-61227379 GGCCAAGGCAGGGGATCACGAGG + Intronic
1118216488 14:63813558-63813580 GCCCAGGGGGGTGGATCACGAGG + Intergenic
1118524196 14:66621655-66621677 GGCCGAGGCGGTGGATCACAAGG - Intronic
1119313989 14:73675780-73675802 GGCCGAGGCAGTGGATCACGAGG + Intronic
1119523061 14:75300492-75300514 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1120163973 14:81174429-81174451 GCCAACGCGGGTGGATCATGAGG + Intergenic
1120556744 14:85937474-85937496 GGCCAGGCGGGTGGATCATGAGG + Intergenic
1121287340 14:92746800-92746822 GCCGAGGGGGGTGGATCATGAGG + Intronic
1121543089 14:94743139-94743161 GGCCAAGGCAGTGGATCACGAGG + Intergenic
1121941902 14:98078819-98078841 GGCCAAGGCGGCGGATCATGAGG + Intergenic
1122446226 14:101771494-101771516 GCCCAGGCGGGTGGATCATGAGG + Intronic
1122518939 14:102329201-102329223 GGCCAAGGCGGTGGATCACAAGG - Intronic
1122580015 14:102765692-102765714 GGCCAAGGCGGGTGATCACGAGG + Intergenic
1122957358 14:105076910-105076932 GCCCACGGCGGGGGAGGATGAGG + Intergenic
1123724869 15:23091826-23091848 GGCCGAGGCGGACGATCATGAGG - Intergenic
1123848090 15:24325112-24325134 GGCTGAGGTGGTGGATCATGAGG + Intergenic
1124285992 15:28400649-28400671 GGCCAGGCGGGTGGATCATGAGG + Intergenic
1124296708 15:28511011-28511033 GGCCAGGCGGGTGGATCATGAGG - Intergenic
1124350295 15:28950391-28950413 GGCCGAGTGGGTGGATCATGAGG + Intronic
1125049806 15:35283528-35283550 GGCCAAAGCGGCGGATCATGAGG - Intronic
1125121517 15:36164300-36164322 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1125244647 15:37620967-37620989 GGCCAGGGCGGCAGATCATGAGG - Intergenic
1125543127 15:40483592-40483614 GCCGAGGGGGGTGGATCATGAGG - Intergenic
1125853970 15:42931501-42931523 GCCAAGGCCGGTGGATCATGAGG + Intergenic
1125884648 15:43219710-43219732 GGCCGAGGCGGAGGATCACGAGG + Intronic
1126030763 15:44495346-44495368 GCCGAGGCCGGTGGATCATGAGG + Intronic
1126665097 15:51068898-51068920 GGCCGAGGGGGCGGATCATGAGG - Intronic
1126962215 15:54009777-54009799 GGCCAAGGCAGCAGATCATGAGG - Intergenic
1127106387 15:55621117-55621139 GGCAAGGTGGGTGGATCATGAGG + Intronic
1127119114 15:55756262-55756284 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1127784100 15:62341042-62341064 GGCCGAGGTGGTGGATCACGAGG + Intergenic
1127880032 15:63149087-63149109 GGCCCAGGCGGCGGATCACGAGG - Exonic
1128358101 15:66942569-66942591 GCCCAGGCAGGTGGATCATGCGG + Intergenic
1129041599 15:72691728-72691750 GGCCGAGGCTGCGGATCATGAGG + Intronic
1129042981 15:72706368-72706390 GTCCACGCAGGTGGATCATGAGG - Intronic
1129868846 15:78928330-78928352 GGCCGAGGCGGTAGATCACGAGG + Intronic
1129988139 15:79936726-79936748 GGCCAAGGGGGTGGATCACAAGG - Intergenic
1130378041 15:83347710-83347732 GCCCAGGGAGGCGGATCATGAGG - Intergenic
1131109031 15:89752806-89752828 GCCAAGGGGGGTGGATCATGAGG + Intergenic
1131221294 15:90586593-90586615 GGCCAAGGTGGGTGATCATGAGG - Intronic
1131221603 15:90589287-90589309 GCCTACGCAGGTGGATCATGAGG - Intronic
1132790817 16:1686454-1686476 GGCCAAGGCAGGTGATCATGAGG + Exonic
1133011776 16:2916908-2916930 GCCGAGGGGGGTGGATCATGAGG + Intronic
1133227757 16:4350633-4350655 GGCCGAGGCGGCGGATCACGAGG - Intronic
1133230318 16:4363330-4363352 GCCCAGGCGGGTGGATCATGAGG + Intronic
1133230343 16:4363470-4363492 GCCCAGGCAGGTGGATCATGAGG + Intronic
1133238997 16:4403659-4403681 GGCCAAGCCGGTGGCCCATGGGG + Intronic
1133365276 16:5204061-5204083 GGCCGAGGCGGTGGATCACGTGG - Intergenic
1133694168 16:8244876-8244898 GGCCAAGGCGACGGATCACGAGG - Intergenic
1133893438 16:9903201-9903223 GGCCGAGGTGGCGGATCATGAGG - Intronic
1133990062 16:10699504-10699526 GGCTAAGCGGGTGGATCATGAGG + Intergenic
1134028625 16:10974129-10974151 GCCCAGGTGGGTGGATCATGAGG - Intronic
1134160802 16:11887927-11887949 GGCCAAGGCGGCGGATCACAAGG + Intronic
1134198784 16:12180717-12180739 GCCGAGGCCGGTGGATCATGAGG - Intronic
1134326168 16:13209864-13209886 GGCCAAGGCGATGGATCACGGGG + Intronic
1134475547 16:14570415-14570437 GACCGAGGCGGCGGATCATGAGG + Intronic
1134507874 16:14822927-14822949 GGCCATGGTGGTGGATGAAGAGG + Intronic
1134692186 16:16198131-16198153 GGCCAGTGCGGTGGGTGATGTGG - Exonic
1134695575 16:16221690-16221712 GGCCATGGTGGTGGATGAAGAGG + Exonic
1134855328 16:17513988-17514010 GGCCGAGGAGGTGGATCACGAGG - Intergenic
1134883897 16:17772887-17772909 GGCCGAGGCGGCGGATCATGAGG - Intergenic
1134976254 16:18572996-18573018 GGCCATGGTGGTGGATGAAGAGG - Intergenic
1135020681 16:18960506-18960528 AGCCGAGGCGGTGGATCACGAGG + Intergenic
1135382764 16:22008218-22008240 GGCCCCGGCGGCGGCCCATGGGG + Exonic
1135546929 16:23372725-23372747 GGCCGAGGCGGTGGATCACGAGG - Intronic
1135625227 16:23989197-23989219 GGCCGAGGCGGCGGATCACGAGG - Intronic
1135873276 16:26171864-26171886 GGCCGAGGCGGCGGATCACGAGG + Intergenic
1136247270 16:28983208-28983230 GGCCTCGGCGGTGGAGCGTCGGG - Exonic
1136564410 16:31061475-31061497 GGGCATGACGGTGGAGCATGTGG - Exonic
1136734052 16:32446594-32446616 GGCCAAGGTGGTGGATCATGAGG - Intergenic
1136747003 16:32599272-32599294 GACCGAGGCGGTGGATCACGAGG + Intergenic
1137057538 16:35752771-35752793 GGCCACGGTGGGGGATCAGGCGG - Intergenic
1137286552 16:47020902-47020924 AGCCAAGGCGATGGATCATGAGG - Intergenic
1137649630 16:50108723-50108745 GGCGAGGTGGGTGGATCATGAGG + Intergenic
1137730494 16:50686146-50686168 GGGCACGGTGGCGGATCACGAGG + Intergenic
1137823991 16:51473960-51473982 AGCCGAGGCGGTGGATCACGAGG - Intergenic
1138336792 16:56259693-56259715 GGGCAGGGCGGGGGTTCATGTGG + Intronic
1138476439 16:57273022-57273044 GGCCGGGCGGGTGGATCATGAGG + Intronic
1139070080 16:63369726-63369748 GGCCGAGGCGATGGATCACGGGG - Intergenic
1139460384 16:67117540-67117562 GGCCGAGGCGGTGGATCACGAGG + Intronic
1139535299 16:67568618-67568640 GCCCAGGCGGGTGGATCATGAGG - Intronic
1139761146 16:69185786-69185808 GGCCAAGGCGGTGGATCACCTGG - Intronic
1139897086 16:70296234-70296256 GGCCAAGGTGGTGGATCACGAGG - Intronic
1139899143 16:70313250-70313272 GCCAAGGCCGGTGGATCATGAGG - Intronic
1140130470 16:72156382-72156404 GCCGACGTGGGTGGATCATGAGG + Intronic
1140496465 16:75393495-75393517 GGGGCCGGGGGTGGATCATGAGG + Intronic
1140659558 16:77174791-77174813 GGCCAAGTCGGTGGATCAGGAGG - Intergenic
1140666497 16:77232983-77233005 GGCCAAGGCGGGCGATCACGAGG + Intergenic
1140739548 16:77929047-77929069 GGCCAAGGGGGCGGATCACGAGG - Intronic
1140863577 16:79040412-79040434 GGCCATGGTGGTGCATCCTGTGG - Intronic
1140967794 16:79984092-79984114 GGCCGAGGGGGTGGATCACGAGG + Intergenic
1141052977 16:80789365-80789387 GGCCGAGGGGGTGGATCACGAGG + Intronic
1141495991 16:84409972-84409994 GGCCTGGGGGGTGGATCACGAGG + Intronic
1141786639 16:86205186-86205208 GCCGAGGCCGGTGGATCATGAGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142371242 16:89683913-89683935 GCCGAGGCCGGTGGATCATGAGG - Intronic
1142454196 16:90207590-90207612 GCCAACGTGGGTGGATCATGAGG + Intergenic
1203019027 16_KI270728v1_random:383001-383023 GGCCAAGGTGGTGGATCATGAGG + Intergenic
1203037362 16_KI270728v1_random:656159-656181 GGCCAAGGTGGTGGATCATGAGG + Intergenic
1203049133 16_KI270728v1_random:858476-858498 GACCGAGGCGGTGGATCACGAGG + Intergenic
1142558096 17:793251-793273 GGCCAAGGCGGCGGATCACAAGG + Intergenic
1142558274 17:794382-794404 GGCCAAGGCGGCGGATCACAAGG - Intergenic
1142674188 17:1503416-1503438 GGCCAGGCGGGTGGATCACGAGG - Intronic
1142700317 17:1655858-1655880 GGCCGAGGCGGCGGATCACGAGG - Intronic
1142743882 17:1945453-1945475 GGCCAAGGCGGTGGATCAAGAGG - Intronic
1143000768 17:3793779-3793801 GGCCAAGGTGGTGGATCACGAGG - Intronic
1143109741 17:4546349-4546371 GGGCAAGGGGGTGGATCACGAGG - Intronic
1143245477 17:5481880-5481902 GGCCAAGGCAGTGGATCACGAGG - Intronic
1143297883 17:5884880-5884902 GCCAAAGGGGGTGGATCATGAGG - Intronic
1143568814 17:7741590-7741612 GCCCAGGTGGGTGGATCATGAGG - Intronic
1143828007 17:9628510-9628532 GGCCAGGGGGGTGGATCACGAGG - Intronic
1143984171 17:10896822-10896844 GGCCAAGGCGGTGGATCATGAGG + Intergenic
1144006965 17:11109576-11109598 GGCCAGGCGGGTGGATCACGAGG + Intergenic
1144334860 17:14259480-14259502 GCCCAGGCCAGTGGATCATGAGG - Intergenic
1144346810 17:14356744-14356766 GCCGACGCCGGGGGATCATGAGG + Intergenic
1144415609 17:15043600-15043622 GCCGAGGCCGGTGGATCATGAGG + Intergenic
1144939732 17:18930136-18930158 GCCGAGGCCGGTGGATCATGAGG + Intronic
1145234485 17:21199084-21199106 GGCCGGGGGGGCGGATCATGAGG + Intronic
1146047916 17:29525768-29525790 GGCCGAGGCAGGGGATCATGAGG + Intronic
1146178413 17:30681523-30681545 GGCCGAGGCAGTGGATCACGAGG + Intergenic
1146237342 17:31179574-31179596 GGCCAAGGCGGCGGATCACGAGG - Intronic
1146297893 17:31664268-31664290 GCCGACGTCGGTGGATCATGAGG + Intergenic
1146385813 17:32372064-32372086 GCCCAGGCGGGTGGATCATGAGG + Exonic
1147296309 17:39485645-39485667 GGCCGAGGCCGGGGATCATGAGG - Intronic
1147378942 17:40040846-40040868 GGCCAAGGGAGTGGATCATGAGG - Intronic
1147432708 17:40383126-40383148 GGCCAAGCGGGTGGATCACGAGG + Intergenic
1147839652 17:43362206-43362228 GGCCCAGGCGGGGGATCATGAGG - Intergenic
1148007008 17:44441081-44441103 GGCCAAGGTGGCAGATCATGAGG - Intronic
1148014414 17:44511068-44511090 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1148430773 17:47641850-47641872 GGCGAGGCGGGTGGATCATGAGG - Intergenic
1148597095 17:48865464-48865486 GCCGAGGCCGGTGGATCATGAGG - Intronic
1148770928 17:50065797-50065819 GCCGAGGCCGGTGGATCATGAGG + Intronic
1148990394 17:51661034-51661056 TGCCATGACAGTGGATCATGGGG - Intronic
1149631072 17:58124248-58124270 GCCGAGGCCGGTGGATCATGAGG + Intergenic
1149802797 17:59586426-59586448 GCCGAGGTCGGTGGATCATGAGG + Intronic
1149843693 17:59989052-59989074 GCCGAGGTCGGTGGATCATGAGG - Intergenic
1150076360 17:62195619-62195641 GCCAAGGGGGGTGGATCATGAGG - Intergenic
1150107893 17:62475893-62475915 GGCCGAGGCGGTGGATCATGAGG - Intronic
1150119087 17:62584347-62584369 GCCGAGGGAGGTGGATCATGAGG - Intronic
1150119765 17:62591015-62591037 GCCGAGGCCGGTGGATCATGAGG + Intronic
1150411423 17:64945554-64945576 GCCGAGGCCGGTGGATCATGAGG + Intergenic
1150606326 17:66694246-66694268 GGCCAGGGTGCTGGATCACGAGG + Intronic
1150826247 17:68478217-68478239 GCCGAGGGGGGTGGATCATGAGG + Intergenic
1151120755 17:71790081-71790103 GCCGAGGCCGGTGGATCATGAGG - Intergenic
1151492192 17:74439412-74439434 GGCCACGGTGGAGGATGAAGGGG - Intronic
1151801140 17:76380602-76380624 GGCCAAGGCGGGTGATCATGAGG - Intronic
1151878902 17:76882945-76882967 GGCCAAACGGGTGGATCATGAGG - Intronic
1152497026 17:80680399-80680421 GCCCAGGTAGGTGGATCATGAGG + Intronic
1152670028 17:81597858-81597880 GGCCAAGACGGTGGATCACGAGG + Intronic
1152909788 17:82995615-82995637 GGCGAGGTGGGTGGATCATGAGG - Intronic
1152940529 17:83170349-83170371 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1152954488 18:26790-26812 GGCCGAGCCGGTGGATCACGAGG - Intergenic
1153194367 18:2577447-2577469 GGCTGAGGCGGTGGATCACGAGG - Intronic
1153217335 18:2832925-2832947 GGCCGAGGCAGTGGATCATGAGG + Intergenic
1153698250 18:7665690-7665712 GCCGAGGGGGGTGGATCATGAGG + Intronic
1153914784 18:9735543-9735565 GGCCATGGCCGTGGCTCGTGTGG + Intronic
1154964240 18:21340775-21340797 GCCCAGGCGGGTGGATCATGAGG - Intronic
1155239855 18:23854747-23854769 GGCCAAGGAGGCGGATCACGAGG + Intronic
1155530425 18:26760954-26760976 GGCCGAGGCGGTGGCTCATGAGG - Intergenic
1155564022 18:27112953-27112975 GCCGAGGCCGGTGGATCATGAGG + Intronic
1155628658 18:27865141-27865163 GGCCAAGGCAGTGGATCACGAGG - Intergenic
1155828010 18:30473522-30473544 GCCAACGAGGGTGGATCATGAGG + Intergenic
1156103892 18:33633607-33633629 GCCAAGGGGGGTGGATCATGAGG + Intronic
1157236877 18:45973272-45973294 GCCAAGGACGGTGGATCATGAGG + Intergenic
1157261758 18:46181478-46181500 GGCTGAGGCGGCGGATCATGAGG + Intronic
1157313920 18:46572787-46572809 GGCCAGGCGGGTGGATCACGAGG + Intronic
1157638504 18:49187151-49187173 GGCCGAGGCGGGCGATCATGAGG - Intronic
1157892219 18:51428510-51428532 GGCCAAGGCGGTGGATTATGAGG + Intergenic
1158578835 18:58663501-58663523 GGCCGAGGCGGGGAATCATGAGG + Intergenic
1158931911 18:62330969-62330991 GGCCAAGGTGGCAGATCATGAGG + Intronic
1159101465 18:63963461-63963483 GGCCGAGGTGGTGGATCACGAGG - Intronic
1159167470 18:64721602-64721624 GCCAAGGGGGGTGGATCATGAGG - Intergenic
1159501048 18:69270525-69270547 GGCCGAGGCGGTGGATCACAAGG + Intergenic
1159758117 18:72390892-72390914 GGCGAGGCAGGTGGATCATGAGG + Intergenic
1159768495 18:72520228-72520250 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1160205419 18:76827418-76827440 GGCCACGTGGGGGGATCACGAGG - Intronic
1160998853 19:1898595-1898617 GGCCAGGCGGGTGGATCATGAGG + Intergenic
1161019457 19:2001260-2001282 GGCCGAGGCAGTGGATCACGAGG + Intronic
1161786756 19:6331381-6331403 GCCGAGGGGGGTGGATCATGAGG - Intronic
1161819964 19:6524061-6524083 GGCCAAAGAGGTGGATCAGGAGG + Intergenic
1161880238 19:6945105-6945127 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1162089136 19:8267054-8267076 GCCAAGGGGGGTGGATCATGAGG + Intronic
1162181719 19:8873777-8873799 GCCCAGGTGGGTGGATCATGAGG - Intronic
1162426103 19:10596917-10596939 GGCCGAGGCGGTGGATCATGAGG + Intergenic
1162707789 19:12568512-12568534 GCCCAGGCGGGTGGATCATGAGG + Intronic
1162944588 19:14034716-14034738 GGCCGAGGCGGTGGATCATGAGG + Intronic
1162970157 19:14176114-14176136 GGCCAAGTGGGCGGATCATGAGG + Intronic
1163231818 19:16008403-16008425 GGCCAAGCGGGTGGATCACGAGG + Intergenic
1163368030 19:16887258-16887280 GGCCAGGTGGGTGGATCACGAGG - Intergenic
1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG + Exonic
1163758001 19:19118280-19118302 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1163898653 19:20081419-20081441 GGCAAGGTGGGTGGATCATGAGG - Intronic
1163954297 19:20621065-20621087 GCCCAGGCAGGTGGATCATGAGG - Exonic
1164019263 19:21283347-21283369 GCCCAAGTGGGTGGATCATGAGG + Intronic
1164059171 19:21651555-21651577 GGCCAGGTGGGTGGATCACGAGG - Intergenic
1164161212 19:22626555-22626577 GGCCAAAGCAGTGGATCACGAGG - Intergenic
1164249528 19:23465072-23465094 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1165492187 19:36130412-36130434 GGCCAAGGCAGTGGATCACAAGG + Intergenic
1165888159 19:39094268-39094290 GCCCAGGTGGGTGGATCATGAGG + Intronic
1166063998 19:40345920-40345942 GGCCAAGGCAGTGGATCACAAGG + Intronic
1166089446 19:40498637-40498659 GGCCAAGGAGGTGGACCATAAGG - Intronic
1166668747 19:44697478-44697500 GGCCAGGGAGGTGGAGGATGGGG + Intergenic
1166697580 19:44862178-44862200 GGCCGAGGCGGCGGATCACGAGG + Intronic
1166784744 19:45360896-45360918 GCCGAGGCCGGTGGATCATGAGG + Intronic
1166787492 19:45377436-45377458 GCCCAGGCAGGTGGATCATGAGG - Intergenic
1166850059 19:45755679-45755701 GGCTGAGGCGGTGGATCACGAGG - Intronic
1166892515 19:46002177-46002199 GGCGAGGCAGGTGGATCATGAGG - Intronic
1166968201 19:46543804-46543826 GGCCAAGGCGGCGGATCACGAGG + Intronic
1167260724 19:48456213-48456235 GCCCACGGGGGTGGTTCCTGAGG + Exonic
1167553136 19:50174846-50174868 GGCCAAGGCGGTGGATCACGAGG + Intergenic
1167824438 19:51959457-51959479 GGCCGAGGCGGTGTATCACGAGG + Intergenic
1167891011 19:52539422-52539444 GGCCAAGGCGGTGGATCACAAGG - Intronic
1167973349 19:53203377-53203399 GGCCAAGGCTGGTGATCATGAGG - Intergenic
1168000125 19:53439036-53439058 GGCCACATGGCTGGATCATGAGG + Intronic
1168033649 19:53701700-53701722 GCCGACGTGGGTGGATCATGAGG - Intergenic
1168108341 19:54178142-54178164 GCCCAAGCAGGTGGATCATGAGG - Intronic
1168388996 19:55990590-55990612 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1168619285 19:57864364-57864386 GCCGAGGGGGGTGGATCATGAGG - Exonic
1168631168 19:57957344-57957366 GGCCAAGGGGGCAGATCATGAGG - Intergenic
1168634562 19:57985692-57985714 GGCGAGGTGGGTGGATCATGAGG + Intronic
925220970 2:2140666-2140688 GGCCGAGGCGGCGGATCATGAGG - Intronic
925429938 2:3782711-3782733 GCCAACGTGGGTGGATCATGAGG - Intronic
926602783 2:14864082-14864104 GGCAAGGCAGGTGGATCATGAGG + Intergenic
927394654 2:22636097-22636119 GGCCGAGGCGGCGGATCACGAGG - Intergenic
927601520 2:24446475-24446497 GCCAAGGGGGGTGGATCATGAGG - Intergenic
928382963 2:30836506-30836528 GGCCGAGGGGGTGGATCATGAGG + Intergenic
929976971 2:46644310-46644332 GGCAAGGTGGGTGGATCATGAGG + Intergenic
930286537 2:49436237-49436259 GCCCAGGCAGGTGGATCATGAGG + Intergenic
930393302 2:50788320-50788342 GGCCGAGGCGGCGGATCACGAGG - Intronic
930404644 2:50940240-50940262 GGCCAAGGCGGAGGATCATGAGG + Intronic
931377526 2:61720744-61720766 GCCGAGGGAGGTGGATCATGAGG + Intergenic
931485796 2:62690327-62690349 GCCGAGGGAGGTGGATCATGAGG + Intronic
931561366 2:63565009-63565031 GGCCAAGGCGGCAGATCATGAGG - Intronic
931799030 2:65740807-65740829 GGCCAAGCGGGTGGATCACGAGG - Intergenic
932208005 2:69900939-69900961 GGCCGAGGCGGGGGATCACGAGG + Intronic
932229421 2:70070560-70070582 GGTCAAGGCGGGCGATCATGAGG + Intergenic
932725229 2:74174031-74174053 GGCCGAGGCAGTGGATCACGAGG + Intronic
932788354 2:74629516-74629538 GCCCAAGTGGGTGGATCATGAGG + Intronic
932799639 2:74729460-74729482 GCCGAGGGAGGTGGATCATGAGG + Intergenic
932930350 2:76029062-76029084 GGCTGAGGCGGTGGATCATGAGG - Intergenic
933207659 2:79527395-79527417 GGCCAAGGCGGTGGATCACAAGG + Intronic
933311820 2:80669924-80669946 GCCGAGGGGGGTGGATCATGAGG - Intergenic
933428100 2:82139127-82139149 GGCCGAGGCGGTGGATCACGAGG - Intergenic
933502161 2:83127061-83127083 GCCGAGGCCGGTGGATCATGAGG - Intergenic
933539921 2:83626592-83626614 GGCCGAGGGGGTGGATCACGAGG - Intergenic
934000601 2:87707571-87707593 GCCCAAGCAGGTGGATCATGAGG - Intergenic
934043811 2:88154102-88154124 GGCCCAGGCGGCGGATCATGAGG + Intergenic
934080980 2:88467531-88467553 GGCCAAGGCGGCGGATCACAAGG + Intergenic
934311687 2:91872829-91872851 GGCCAAGGCGGTGGATCATGAGG + Intergenic
934484745 2:94695284-94695306 GGCCGAGGCGGATGATCATGAGG + Intergenic
934665530 2:96167083-96167105 GGCCAAGGCGGCAGATCATGAGG + Intergenic
934904753 2:98189171-98189193 GGCCAAGGGGGTGGATCATGAGG + Intronic
934964305 2:98706560-98706582 GCCGACGCGGGTGGATCATGAGG - Intronic
935004865 2:99063568-99063590 GGCAAGGTGGGTGGATCATGAGG + Intronic
935430651 2:102972525-102972547 GGCGAGGCGGGTGGATCATGAGG + Intergenic
935525622 2:104163131-104163153 GCCCAGGCGGGTGGATCATGAGG + Intergenic
935821135 2:106893999-106894021 GGCCAAGGTGGTAGATCACGAGG - Intergenic
936025261 2:109026829-109026851 GGCCAAGGTGGTGGATCACGAGG + Intergenic
936026375 2:109034025-109034047 GGCCAGGTGGGTGGATCACGAGG + Intergenic
936439011 2:112534084-112534106 GGCCAAGGCGGGCGATCACGAGG + Exonic
936722412 2:115268912-115268934 GGCCGAGGCGGCGGATCATGAGG + Intronic
936757368 2:115731123-115731145 GCCAAGGCCGGTGGATCATGAGG + Intronic
936923754 2:117715632-117715654 GGCGAGGTGGGTGGATCATGAGG + Intergenic
937546767 2:123031822-123031844 GGCCAAGGCGGCGGATCACGAGG + Intergenic
938228286 2:129636473-129636495 GGCCAAGGGGGTGGATCATGAGG - Intergenic
940060350 2:149558997-149559019 GGCCTAGGCGGCGGATCACGAGG + Intergenic
940407873 2:153326849-153326871 GCCAAGGCCGGTGGATCATGAGG + Intergenic
940506781 2:154565555-154565577 GGTCAAGGCGGTGGATCATGAGG - Intergenic
940579897 2:155565116-155565138 GGCCGAGGCGGTTGATCACGAGG - Intergenic
940651839 2:156448340-156448362 GGCCAAGGTGGTGGATCACGAGG - Intronic
940662086 2:156558848-156558870 GCCGAGGCCGGTGGATCATGAGG - Intronic
940754801 2:157669916-157669938 GGCCAAGGTGGCGGATCACGAGG + Intergenic
940791640 2:158035387-158035409 GGCCAAGCAGGTGGATTATGAGG - Intronic
940998043 2:160171567-160171589 GGCCGAGGCGGTGGATCACGAGG - Intronic
941804544 2:169697247-169697269 GGCCGAGGCGGGGGATCACGAGG - Intronic
941968264 2:171322196-171322218 GGCCGAGGAGGCGGATCATGAGG - Exonic
942021244 2:171868078-171868100 GGCCAAGTGGGTGGATCACGAGG - Intronic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
942593087 2:177567025-177567047 GCCAACGTGGGTGGATCATGAGG - Intergenic
943457000 2:188120568-188120590 GGCCGAGGCGGCGGATCACGAGG - Intergenic
943721507 2:191207601-191207623 GGCCAGTGTGGTGGCTCATGTGG + Intergenic
944243369 2:197507442-197507464 GGCCGAGGCGGCGGATCACGAGG - Intronic
944735929 2:202564810-202564832 GGCCGAGACGGTGGATCACGAGG + Exonic
945164101 2:206923837-206923859 GGCCAAGGTGGTGGATCACAAGG + Intergenic
945223414 2:207507428-207507450 AGCCGAGGCGGTGGATCACGAGG + Intergenic
945229600 2:207571991-207572013 GGCCAAGGTGGTGGATCATGAGG + Intronic
945820868 2:214663946-214663968 GGCCGAGGCAGCGGATCATGAGG + Intergenic
945859900 2:215108832-215108854 GGCCGAGGCGGTGGATCACGAGG + Intronic
946522757 2:220484747-220484769 GCCGACGCAGGTGGATCATGAGG - Intergenic
948224666 2:236299536-236299558 GCCCAGGTGGGTGGATCATGAGG + Intergenic
949085650 2:242152252-242152274 GCCAACGTGGGTGGATCATGAGG + Intergenic
1168748482 20:265257-265279 GGCCAAGGCGGCAGATAATGAGG - Intergenic
1168766739 20:386803-386825 GGCCAAGGTGGTGGATCATGAGG - Intronic
1168832653 20:855183-855205 GCCCAGGTGGGTGGATCATGAGG + Intronic
1169172287 20:3474471-3474493 GGCCGAGGCGGTGTATCACGAGG + Intronic
1169651291 20:7870679-7870701 GGCCAGGCAGGTGGGTCATGAGG - Intergenic
1170818130 20:19732385-19732407 AGCCAAGGTGGTGGATCACGAGG - Intergenic
1171844850 20:30261368-30261390 GGCAAGGTGGGTGGATCATGAGG - Intergenic
1171983371 20:31642670-31642692 GGCCGAGGTGGTGGATCACGAGG - Intronic
1172143954 20:32743408-32743430 GGCGGCGGCGGTGGAACCTGCGG - Exonic
1172286240 20:33742428-33742450 GGCCGAGGCGGGTGATCATGAGG - Intronic
1172417053 20:34778135-34778157 GGCCGAGGCGGGCGATCATGAGG - Intronic
1173069655 20:39750770-39750792 GGCTGAGGCAGTGGATCATGAGG - Intergenic
1173245969 20:41337692-41337714 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1173366244 20:42388022-42388044 GGCCAAGGTGGGGGATCACGAGG - Intronic
1173384322 20:42573980-42574002 GGCCGAGGTGGTGGATCACGAGG - Intronic
1173796564 20:45864934-45864956 GCCCAGGTGGGTGGATCATGAGG + Intronic
1174248969 20:49203917-49203939 GGCCAAGGCGGCGGATCACAAGG - Intergenic
1174527871 20:51188209-51188231 GGCCAAGGTGGCAGATCATGAGG - Intergenic
1174698821 20:52587300-52587322 GGCCAAGGCAGGTGATCATGAGG + Intergenic
1174817308 20:53697809-53697831 GGCCAAGGCGGCGGATCACAAGG + Intergenic
1175620664 20:60444366-60444388 GCCGAAGGGGGTGGATCATGAGG - Intergenic
1175861215 20:62151381-62151403 GGCCATGGCAATGGACCATGTGG - Intronic
1176879612 21:14174785-14174807 GGCCGAGGCGGGGGATCACGAGG - Intronic
1176957165 21:15118751-15118773 GCCGACGTGGGTGGATCATGGGG + Intergenic
1177483845 21:21729246-21729268 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1177580438 21:23015503-23015525 GTCCAGGCAGGTGGATCATGAGG - Intergenic
1177690485 21:24500105-24500127 GGCCGAGGTGGTGGATCACGAGG + Intergenic
1177701330 21:24643307-24643329 GCCGACGGCGGTGGATCATGAGG + Intergenic
1178051508 21:28752869-28752891 GGCCACGGCAGAGGCCCATGGGG + Intergenic
1178122742 21:29485566-29485588 GGCCGAGGCAGAGGATCATGAGG - Intronic
1178128337 21:29541198-29541220 GCCAAGGGGGGTGGATCATGAGG - Intronic
1178326367 21:31648447-31648469 GCCGAGGTCGGTGGATCATGAGG + Intergenic
1178333978 21:31727557-31727579 GGCCAGGAGGGTGGATCACGAGG + Intronic
1178511605 21:33209858-33209880 GGCCGAGGCGGGGAATCATGAGG + Intergenic
1178847961 21:36189497-36189519 GGCCAAGACGGTGGATCACAAGG + Intronic
1178881155 21:36451121-36451143 GGCCAAGGCGGCAGATCACGAGG - Intergenic
1179205392 21:39272198-39272220 GGCGACGCGGGTGGATCACGAGG + Intronic
1179396125 21:41041512-41041534 GGCCAAGGTGGTGGATCACGAGG + Intergenic
1179420583 21:41233100-41233122 GGCGAGGCAGGTGGATCATGAGG - Intronic
1179592283 21:42416697-42416719 GGCCGAGGCGGCGGATCATGAGG + Intronic
1179645584 21:42773570-42773592 GGCCAAGGCGGCGGATCACGAGG + Intronic
1180538435 22:16418643-16418665 GGCCAAGGCAGTGGATCATGAGG + Intergenic
1180793399 22:18589799-18589821 GCCGAGGCCGGTGGATCATGAGG - Intergenic
1180870341 22:19142970-19142992 GCCAAGGGAGGTGGATCATGAGG + Intronic
1180888716 22:19269165-19269187 GGCCAAGGGGGTGGATCATGAGG + Intronic
1181147846 22:20861344-20861366 GGCCGAGGTGGTGGATCACGAGG - Intronic
1181180513 22:21064694-21064716 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1181228340 22:21405513-21405535 GCCGAGGCCGGTGGATCATGAGG + Intergenic
1181250310 22:21529337-21529359 GCCGAGGCCGGTGGATCATGAGG - Intergenic
1181280898 22:21719791-21719813 GCCCAGGCGGGTGGATCATGAGG + Intronic
1181293343 22:21815295-21815317 GGCCGAGGCCGAGGATCATGAGG - Intronic
1181542653 22:23581836-23581858 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1182186508 22:28408621-28408643 GCCGACGCAGGTGGATCATGAGG - Intronic
1182335196 22:29579528-29579550 GGCCGAGGCGGTGGATCACGAGG - Intronic
1182590163 22:31373206-31373228 GGCGAAGCGGGTGGATCATGAGG - Intergenic
1183142537 22:35956592-35956614 GGCTGAGGCGGGGGATCATGAGG - Intronic
1183634223 22:39051301-39051323 GGCCAAGGCGGGGGATCACGAGG + Intronic
1183809867 22:40246420-40246442 GGCCAAGGTGGGGGATCACGAGG - Intronic
1183888481 22:40905312-40905334 GGCCGAGGCGGTGGTTCACGAGG - Intronic
1183910840 22:41077887-41077909 GGCCAAGCGGGTGGATCACGAGG + Intergenic
1183990616 22:41594868-41594890 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1183997120 22:41643174-41643196 GGCCAAGGGGGCGGATCATGAGG + Intronic
1184076042 22:42178810-42178832 GGCCGGGCGGGTGGATCATGGGG - Intronic
1184480255 22:44742600-44742622 GCCCAGGCAGGTGGATCATGAGG - Intronic
1184618933 22:45659335-45659357 GCCAAGGTCGGTGGATCATGAGG - Intergenic
949281404 3:2352154-2352176 GCCCAGGTGGGTGGATCATGAGG + Intronic
950061470 3:10075417-10075439 GGCCAAGGCGGGTGATCACGAGG - Intronic
950067351 3:10123666-10123688 GGCCAAGGCAGTGGATCACGAGG - Intronic
950492279 3:13313231-13313253 GGCCAAGGCGGCGGATCACAGGG - Intergenic
952439536 3:33311856-33311878 GGCCAAGGCGAGGGATCATGGGG - Intronic
953608282 3:44426199-44426221 GCCAAGGCCGGTGGATCATGAGG - Intergenic
953649887 3:44792778-44792800 GCCCAGGTGGGTGGATCATGAGG - Intronic
953770531 3:45775972-45775994 GACCACGGCAGGGGATCCTGTGG + Exonic
953986250 3:47445478-47445500 GGCCGAGGCGGTGGATCACCTGG - Intronic
954018861 3:47720355-47720377 GGCTGAGGCAGTGGATCATGAGG - Intronic
954073657 3:48160917-48160939 GGCTGAGGCGGTGGATCACGAGG + Intronic
954172179 3:48813458-48813480 GGCCGAGGCGGCGGATCACGAGG + Intronic
954180154 3:48875333-48875355 GGCCGAGGGGGTGGATCACGAGG - Intronic
954552948 3:51497352-51497374 GGCCTAGGCGGTGGATCACGAGG + Intronic
954617947 3:51979715-51979737 GGCCGAGGTGGCGGATCATGAGG - Intronic
955603060 3:60668797-60668819 GGCGAGGCAGGTGGATCATGAGG - Intronic
955715324 3:61823420-61823442 GGCCGAGGCGGTGGATCACGAGG - Intronic
957191532 3:77016208-77016230 GGCCGAGGCGGCGGATCATGAGG - Intronic
957309356 3:78500234-78500256 GCCCAGGCGGGTGGATCATGAGG + Intergenic
957619715 3:82579442-82579464 GGCCAAGGCGGGCGATCACGAGG - Intergenic
957991753 3:87635320-87635342 GGCCAGGCGGGTGGATCACGAGG + Intergenic
958562496 3:95765096-95765118 GGCCGAGGTGGAGGATCATGAGG - Intergenic
959407085 3:105973235-105973257 GGCCAAAGCGGTGGATCACGAGG + Intergenic
959807212 3:110570211-110570233 GCCGAGGGGGGTGGATCATGAGG - Intergenic
959924434 3:111905589-111905611 GACCAAGGCGGTGGATCACTTGG - Intronic
960083700 3:113568358-113568380 GGCCGAGGAGGTGGATCACGAGG + Intronic
961476557 3:127150381-127150403 GGCCATGGCCCTGGATCATCCGG - Intergenic
961769308 3:129237036-129237058 GGCCAAGGCGGCAGATCACGAGG - Intergenic
962514693 3:136139458-136139480 GGCCGAGGGGGGGGATCATGAGG + Intronic
962579026 3:136781105-136781127 GGCCGAGGCGGTGGATCAAAAGG + Intergenic
963590304 3:147249118-147249140 GCCGAGGCCGGTGGATCATGAGG + Intergenic
964115426 3:153132122-153132144 GGCAAGGTGGGTGGATCATGAGG - Intergenic
964395218 3:156238186-156238208 GGCCGAGGCGGCGGATCACGAGG + Intronic
965124706 3:164611459-164611481 GGCCGAGGTGGTGGATCACGAGG - Intergenic
965202381 3:165676425-165676447 GGCCGAGGGGGTGGATCATGAGG + Intergenic
965211370 3:165793809-165793831 GGCCAAGGCGGTGGATCACCTGG + Intronic
966002602 3:174968710-174968732 GGCCGAGGCGGCGGATCACGAGG - Intronic
966187694 3:177242874-177242896 GCCAAGGCCGGTGGATCATGAGG - Intergenic
966336261 3:178871656-178871678 GGCCGAGGCAGTGGATCACGAGG - Intergenic
966409762 3:179636055-179636077 GCCAAGGGGGGTGGATCATGAGG - Intergenic
966812431 3:183859069-183859091 GGCCGAGGCGGTGGATCACGAGG + Intronic
966983578 3:185159840-185159862 GGCCAAGGTGGTGGAGCACGAGG - Intergenic
967544762 3:190712130-190712152 GCCAAGGCCGGTGGATCATGAGG - Intergenic
967579508 3:191135904-191135926 GGCCGAGGCGGGGGATCACGAGG - Intergenic
967717385 3:192777779-192777801 GGCCAAGGCGGCGGATCATGAGG - Intergenic
967827664 3:193891350-193891372 GCCCACGTGGGTGGATCATGAGG + Intergenic
968178449 3:196570943-196570965 GGCCAAGGCGACGGATCACGAGG - Intronic
968298914 3:197598745-197598767 GGCCAAGGCGGTGGATCATGAGG - Intergenic
968384902 4:127056-127078 GCCAAGGCCGGTGGATCATGAGG - Intronic
968421208 4:486390-486412 GGCCAAGGCGGGCGGTCATGAGG - Intronic
968713447 4:2137607-2137629 GGCCACGGGAGTGTATCAGGAGG - Intronic
968715521 4:2156065-2156087 GGCCGAGGCGGTGGATCATGAGG - Intronic
968802787 4:2754648-2754670 GGCCAAGGCGGCGGATCACGAGG - Intronic
969311337 4:6354471-6354493 GGGCACGGAGGTGAATCAGGAGG - Intronic
969330577 4:6471815-6471837 GGCCACGGCTGTGGCTAATCTGG - Intronic
970283831 4:14486905-14486927 GGCCAAGGTGGGGGATCACGAGG + Intergenic
970526031 4:16933149-16933171 GCCGAGGGGGGTGGATCATGAGG + Intergenic
970756497 4:19433190-19433212 GGCCAAGCTGGTGGATCATGAGG - Intergenic
970762134 4:19502744-19502766 GGCCAAGGCGGTGGATCACGAGG - Intergenic
970763809 4:19522654-19522676 GGCCGAGGTGGTGGATCACGAGG + Intergenic
971082262 4:23227109-23227131 GGCCAAGGCGGGGAATCACGAGG - Intergenic
971242945 4:24905132-24905154 GGCCACGGCGGTGGATCATGAGG - Intronic
971705547 4:30037906-30037928 GGCGAGGCGGGTGGATCATGAGG + Intergenic
972421352 4:38890168-38890190 GGCCAAGGGGGCGGATCATGAGG + Intronic
972499098 4:39661254-39661276 GGCCAAGCGGGTGGATCACGGGG - Intergenic
972533963 4:39984430-39984452 GGCCAAGGGGGCGGATCACGAGG - Intergenic
972540040 4:40031277-40031299 GGCCGAGGGGGCGGATCATGAGG - Intergenic
972630078 4:40835041-40835063 GGCCAAGGTGGCAGATCATGAGG + Intronic
972649684 4:41004600-41004622 GGCAAGGCGGGTGGATCATGAGG + Intronic
972774897 4:42231473-42231495 GGCCGAGGTGGTGGATCACGAGG - Intergenic
973005948 4:45007072-45007094 GGCCGAGGCGGTGGATCACGAGG + Intergenic
973665639 4:53156147-53156169 GCCCAGGTGGGTGGATCATGAGG + Intronic
973681783 4:53327894-53327916 GCCAACGTGGGTGGATCATGAGG + Intronic
974038092 4:56834694-56834716 GTCAACGTGGGTGGATCATGAGG + Intergenic
974041264 4:56859810-56859832 GGCCGAGGTGGTGGATCATGAGG - Intergenic
974154324 4:58051497-58051519 GGCGAGGTGGGTGGATCATGAGG + Intergenic
974240843 4:59244578-59244600 GCCAAGGCCGGTGGATCATGAGG + Intergenic
974305852 4:60139158-60139180 GGCTGAGGGGGTGGATCATGAGG - Intergenic
974390364 4:61259187-61259209 GGCCGAGGCGGCGGATCACGAGG + Intronic
974400076 4:61392101-61392123 GCCCAGGCGGGTGGATCATGAGG - Intronic
974586649 4:63888587-63888609 GGCCAAGGGGGTGGATCACGAGG + Intergenic
974708161 4:65550599-65550621 GCCCAGGCAGGTGGATCATGAGG + Intronic
975099987 4:70501824-70501846 GCCCAGGTGGGTGGATCATGAGG + Intergenic
975142087 4:70928527-70928549 GGCTGAGGCGGTGGATCACGAGG - Intronic
975423419 4:74196711-74196733 GGCCGAGGTGGTGGATCACGAGG + Intronic
975567999 4:75780504-75780526 GGCCACGTGGGCGAATCATGAGG - Intronic
975930276 4:79513015-79513037 GGCCAAGCAGGCGGATCATGAGG - Intergenic
976180786 4:82396791-82396813 GGCGAGGCGGGTGGATCATGAGG + Intergenic
977685960 4:99848044-99848066 GGCCGAGGGGGCGGATCATGAGG - Intronic
977931486 4:102754788-102754810 GGCCAAGGCGGCAGATCACGAGG - Intronic
978176990 4:105743892-105743914 GGCCAAGGCGGGCGATCACGAGG - Intronic
978349671 4:107808520-107808542 GGCTGAGGCGGTGGACCATGAGG - Intergenic
978787408 4:112625349-112625371 GGCCGAGGCGGCGGATCACGAGG + Intronic
979738302 4:124117565-124117587 GGCCGAGGCGGCGGATCACGAGG + Intergenic
979843589 4:125478761-125478783 GGCTGAGGTGGTGGATCATGAGG - Intronic
980574039 4:134662642-134662664 GCCGACGCGGGTGGATCATGAGG - Intergenic
980772500 4:137395105-137395127 GCCCAAGTGGGTGGATCATGAGG + Intergenic
981480418 4:145233045-145233067 GGCCAAGGCGGGTGATCATGAGG + Intergenic
982262160 4:153504200-153504222 GGCCGAGGCGGTGGATCACAAGG - Intronic
982731098 4:158956328-158956350 GGCCGCGTGGGTGGATCACGAGG + Intronic
983083701 4:163417682-163417704 GGCCAAGTGGGTGGATCACGAGG + Intergenic
983882536 4:172949673-172949695 GCCAACGCGGGTGGATCATGAGG + Intronic
984135754 4:175936069-175936091 GCCGAGGGGGGTGGATCATGAGG + Intronic
984452072 4:179914733-179914755 GGCCAAGGCAGGGGGTCATGAGG + Intergenic
985082358 4:186279147-186279169 GGCCGAGGCGGTGAATCACGAGG + Intronic
985110014 4:186538982-186539004 GGCCGAGGCGGGGGATCACGAGG + Intronic
985135703 4:186783834-186783856 GGCCAAGGGGGTGGATCACGAGG + Intergenic
985274241 4:188222379-188222401 GGCCGAGGCAGTGGATCATGAGG + Intergenic
985398798 4:189573149-189573171 GGCCAGGAGGGCGGATCATGAGG + Intergenic
985483567 5:135429-135451 GGCCGAGGTGGCGGATCATGAGG + Intergenic
986184914 5:5426210-5426232 GGCCAAGGCAGTGGATCACGAGG + Intronic
986438929 5:7761380-7761402 GGCCGAGGCAGTGGATCACGCGG - Intronic
986751675 5:10793242-10793264 GCCCAAGCAGGTGGATCATGAGG - Intergenic
987062840 5:14258765-14258787 GGCCACTGCTGTGGAGCAGGAGG - Intronic
987135479 5:14896119-14896141 GCCCAGGTGGGTGGATCATGAGG - Intergenic
987190332 5:15470806-15470828 GGCGAGGCAGGTGGATCATGAGG - Intergenic
987343868 5:16961796-16961818 GGCCGAGGCGGTGGATCACAAGG - Intergenic
988117108 5:26909216-26909238 GGCCAAGGCGGGCGATCATGAGG - Intronic
988143320 5:27270625-27270647 GTCAACGCGGGTGGATCATGAGG - Intergenic
988167098 5:27607393-27607415 GGTCGCGGCGGCGGATCATGAGG - Intergenic
988664557 5:33311123-33311145 GCCGAGGCCGGTGGATCATGAGG - Intergenic
989383384 5:40831009-40831031 GGCCGAGGCGGCGGATCACGAGG + Exonic
991266763 5:64728956-64728978 GGCGAGGCGGGTGGATCATGAGG + Intronic
991540223 5:67719645-67719667 GGCCGAGGCGGCGGATCACGAGG - Intergenic
992232727 5:74679563-74679585 GGCCAAGGTGGTGGATCACTTGG + Intronic
992263135 5:74990577-74990599 GGTCATGGCTGTGGATCACGTGG + Intergenic
992330189 5:75709063-75709085 GTCCAGGGCTGTGGATCAAGAGG - Intronic
992622592 5:78608696-78608718 GCCGAGGGAGGTGGATCATGAGG + Intronic
992722165 5:79571166-79571188 GGCCGAGCGGGTGGATCATGAGG - Intergenic
992888092 5:81178970-81178992 GGCCAAGGCGGTGGATCATGAGG - Intronic
993024814 5:82632942-82632964 GGCCGAGTGGGTGGATCATGAGG - Intergenic
993414679 5:87611992-87612014 GCCGAGGGGGGTGGATCATGCGG + Intergenic
993497931 5:88628812-88628834 GCCCAGGTGGGTGGATCATGAGG + Intergenic
993581487 5:89667141-89667163 GCCGAGGGTGGTGGATCATGAGG - Intergenic
993805267 5:92399934-92399956 GGCCGAGGTGGGGGATCATGAGG - Intergenic
994084222 5:95741092-95741114 GCCGACGCGGGTGGATCATGAGG + Intronic
994757897 5:103817598-103817620 GGCAAGGTGGGTGGATCATGAGG + Intergenic
995368030 5:111385807-111385829 GGCAAGGTAGGTGGATCATGAGG - Intronic
995497150 5:112758557-112758579 GGCCGAGGCGGTGGATCACGAGG - Intronic
996588200 5:125115381-125115403 GGACACGGTGGTTGAGCATGTGG - Intergenic
996883229 5:128324851-128324873 GCCAAGGCCGGTGGATCATGAGG - Intronic
997043093 5:130280346-130280368 GGCTGAGGCGGTGGATCATGAGG + Intergenic
997054820 5:130429341-130429363 GGCCAAGGCGGCAGATCACGAGG + Intergenic
997261466 5:132468498-132468520 GCCGAGGCCGGTGGATCATGAGG - Intronic
997322586 5:132990826-132990848 GCCCAGGTGGGTGGATCATGAGG + Intergenic
997902328 5:137778334-137778356 GGCCAGGCAGGCGGATCATGAGG - Intergenic
997915104 5:137916710-137916732 GGCCAAGGTGGTGGATCACAGGG - Intronic
997938232 5:138133338-138133360 GGCCGAGGCGGCAGATCATGAGG - Intronic
997983247 5:138483475-138483497 GGCCAAGGTGGGGGATCACGAGG - Intergenic
997991983 5:138552138-138552160 GGCCAAGGCGGCTGATCACGAGG + Intergenic
998088469 5:139346469-139346491 GGCCAAGGGGGTGGATCATGAGG - Intronic
998544275 5:143012886-143012908 GCCCAGGCGGGTGGATCATGAGG - Intronic
998588883 5:143456549-143456571 GGCGAGGCAGGTGGATCATGAGG - Intergenic
999299761 5:150484124-150484146 GGCCAAGGTGGTGGATCACAAGG - Intergenic
999811624 5:155132747-155132769 GGCCATGGGGTAGGATCATGTGG + Intergenic
999823965 5:155256477-155256499 GCCGACGCAGGTGGATCATGAGG + Intergenic
999829010 5:155301317-155301339 GGCCGAGGGGGTGGATCATGAGG - Intergenic
1000613779 5:163405546-163405568 GCCGACGCGGGTGGATCATGAGG - Intergenic
1000875895 5:166637932-166637954 GGCCAAGGCGGTGGATCCCAAGG + Intergenic
1001119718 5:168969945-168969967 GCCGAGGCCGGTGGATCATGAGG + Intronic
1001523730 5:172414066-172414088 GGCCTCTGCAGTGGAGCATGGGG + Intronic
1001606895 5:172967086-172967108 GCCAAAGCCGGTGGATCATGAGG - Intronic
1001786387 5:174417538-174417560 GCTGACGGGGGTGGATCATGAGG - Intergenic
1001806087 5:174587830-174587852 GCCGAGGGGGGTGGATCATGAGG - Intergenic
1001992460 5:176129279-176129301 GCCCAGGGAGGTGGATCACGAGG - Intronic
1002120486 5:177000187-177000209 GGCCGAGGCGGCGGATCATGAGG - Intronic
1002177272 5:177408286-177408308 GCCAAGGTCGGTGGATCATGAGG - Intronic
1002486735 5:179543587-179543609 GGCCGAGGCGGCAGATCATGAGG - Intergenic
1002499120 5:179635747-179635769 GCCCAGGTGGGTGGATCATGTGG + Intergenic
1002502556 5:179656776-179656798 GCCCAGGTGGGTGGATCATGTGG - Intergenic
1002551670 5:179998072-179998094 GGCCAAGGTGGCGGATCACGAGG - Intronic
1002629368 5:180560177-180560199 GGCGAAGTGGGTGGATCATGAGG - Intronic
1002692923 5:181063268-181063290 GGCCGAGGCGGTGGATCACAAGG + Intergenic
1002737786 5:181409135-181409157 GCCAACGTGGGTGGATCATGAGG + Intergenic
1002986509 6:2193955-2193977 GGCCGAGCGGGTGGATCATGAGG - Intronic
1003153802 6:3574475-3574497 GGCCAAGGTGGCGGATCACGAGG - Intergenic
1003205561 6:4007367-4007389 GGCCACGGGGGCGGATCACAAGG + Intergenic
1003269816 6:4598169-4598191 GCCGAGGCCGGTGGATCATGAGG - Intergenic
1003278127 6:4669725-4669747 GGCCGAGGCGGCGGATCAGGAGG - Intergenic
1003507035 6:6748630-6748652 GGCCATGGCCATGGAGCATGTGG + Intergenic
1003709154 6:8569587-8569609 GCCGACGGGGGCGGATCATGAGG - Intergenic
1004103537 6:12641302-12641324 GCCAAGGGGGGTGGATCATGAGG + Intergenic
1004358051 6:14947159-14947181 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1004444637 6:15686774-15686796 GGCCGAGGCGGCGGATCACGAGG + Intergenic
1004470034 6:15920868-15920890 GCCCACTGCAGTGGTTCATGGGG - Intergenic
1004617315 6:17303094-17303116 GGCCGAGGCGGCTGATCATGAGG + Intergenic
1004666129 6:17750192-17750214 GGCCGAGGCGGGGGATCACGAGG - Intergenic
1004699006 6:18061150-18061172 GGCCAAGGGGGCGGATCACGAGG - Intergenic
1004777778 6:18867978-18868000 GGCTGAGGCGGTGGATCACGAGG + Intergenic
1005065501 6:21813968-21813990 GGCCAAGGCGATGGATCACGAGG - Intergenic
1005144699 6:22675362-22675384 GGCCGAGGAGGCGGATCATGAGG + Intergenic
1005498449 6:26409503-26409525 GGCAACGGCTGTGGGTCATGGGG - Intronic
1005768497 6:29039455-29039477 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1005976046 6:30800556-30800578 GCCAAGGGAGGTGGATCATGAGG - Intergenic
1006214263 6:32426217-32426239 GGCCAAGCGGATGGATCATGAGG + Intergenic
1006465720 6:34193560-34193582 GCCAAGGGGGGTGGATCATGAGG + Intergenic
1006491164 6:34389727-34389749 GCCAACGCGGGTGGATCATGAGG + Intronic
1006763632 6:36485725-36485747 GGCCGAGGCGGCGGATCACGAGG - Intronic
1006854828 6:37125580-37125602 GGCCGAGGCGGCGGATCACGAGG - Intergenic
1007428603 6:41763371-41763393 GGGCCAGGCTGTGGATCATGAGG - Intergenic
1007439891 6:41849838-41849860 GGTCGAAGCGGTGGATCATGAGG - Intronic
1007477401 6:42128158-42128180 GGCCAAGGGGGCAGATCATGAGG - Intronic
1007755219 6:44095100-44095122 GGCCAGGGATGTGGAACATGAGG + Intergenic
1008018160 6:46544868-46544890 GGCCAGGCAGGTGGATTATGAGG + Intergenic
1008632925 6:53381520-53381542 GGCCACAGAGGTGGAGCAGGTGG - Intergenic
1009199837 6:60730824-60730846 GGCCGAGGCGGCAGATCATGAGG + Intergenic
1009429192 6:63547743-63547765 GCCGAGGGGGGTGGATCATGAGG - Intronic
1009650896 6:66476978-66477000 GGCCGAGGCGGCGGATCACGAGG - Intergenic
1009936018 6:70235218-70235240 GCCCATGTGGGTGGATCATGAGG + Intronic
1010638347 6:78288081-78288103 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1010795892 6:80115868-80115890 GCCGAGGGGGGTGGATCATGAGG - Intronic
1011352660 6:86439615-86439637 GCCCAGGCAGGTGGATCATGAGG - Intergenic
1011482624 6:87810427-87810449 GGCCGAGGCGGCGGATCACGAGG - Intergenic
1011563613 6:88649461-88649483 GGCCGAGGCGGTGGATCACGAGG + Intronic
1011636633 6:89380671-89380693 GCCCAGGCAGGTGGATCATGAGG + Intronic
1011681379 6:89786691-89786713 GGCCAAGGCGGAGGATCATGAGG + Intronic
1011746287 6:90410770-90410792 GGCTGAGGTGGTGGATCATGAGG + Intergenic
1012198410 6:96374381-96374403 GGCCAAGGCGGTGGATCACGAGG + Intergenic
1012219431 6:96630297-96630319 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1012725190 6:102801810-102801832 GGCGAGGCAGGTGGATCATGAGG - Intergenic
1012995628 6:105970440-105970462 GGCCAAGGCAGGTGATCATGAGG - Intergenic
1013417327 6:109936682-109936704 GGCCAGGAGGGTGGATCACGAGG - Intergenic
1013498939 6:110728053-110728075 GGCCAAGGTGGGGGATCACGAGG + Intronic
1013936729 6:115605243-115605265 GGCCGAGGCGGCGGATCACGAGG - Intergenic
1013969714 6:116002382-116002404 GCCAAGGGCGGTGGATCACGAGG + Intronic
1014429160 6:121345898-121345920 GGTCACGGTGGTAGATCACGAGG + Intergenic
1014444580 6:121512763-121512785 GCCAAGGCCGGTGGATCATGAGG - Intergenic
1014492611 6:122081396-122081418 GCCGAGGGGGGTGGATCATGAGG + Intergenic
1015045357 6:128769563-128769585 GCCGAGGGGGGTGGATCATGAGG + Intergenic
1015116597 6:129656406-129656428 GGCCCAGGCGGTGGATCACGAGG + Intronic
1015397672 6:132753257-132753279 GCCCAGGTGGGTGGATCATGAGG - Intronic
1015523560 6:134154592-134154614 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1016434220 6:144019237-144019259 GGCCAAGTGGGTGGATCACGAGG + Intronic
1017337818 6:153282673-153282695 GGCCGTGGCGGTGGCTCACGTGG + Intergenic
1018283750 6:162215809-162215831 GGCAAGGTGGGTGGATCATGAGG + Intronic
1018771961 6:166978725-166978747 GGCCGAGGGGGTGGGTCATGAGG + Intergenic
1019242884 6:170684692-170684714 GCCAACGTGGGTGGATCATGAGG + Intergenic
1019974414 7:4569238-4569260 GCCGACGCGGGTGGATCATGAGG - Intergenic
1020062149 7:5160598-5160620 GGCCAAGGCGGGGGATCACGAGG + Intergenic
1020165995 7:5808079-5808101 GGCCAAGGCGGGGGATCACGAGG - Intergenic
1020198362 7:6059657-6059679 GGCTGAGGCGGTGGATCATGAGG + Intergenic
1020243837 7:6415601-6415623 GGCCAAGGTGGCGGATCATGAGG + Intronic
1020669092 7:11083693-11083715 GGCCAAGGGGGTGGGTCACGAGG - Intronic
1020671020 7:11112535-11112557 GTCGAGGGAGGTGGATCATGAGG + Intronic
1020816177 7:12908750-12908772 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1021125846 7:16850875-16850897 GGCCACTGCGGGGGATCCAGGGG + Intergenic
1021475259 7:21054004-21054026 GGCCAAGCGGGTGGATCACGAGG + Intergenic
1021654576 7:22862549-22862571 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1022033506 7:26513542-26513564 GGCGAGGCGGGTGGATCATGAGG - Intergenic
1022275967 7:28855367-28855389 GCCGAGGGGGGTGGATCATGAGG - Intergenic
1022659886 7:32357096-32357118 GGCCAGGCGGGTGGATCACGAGG + Intergenic
1022719240 7:32927993-32928015 GGCCGAGGCGGTGGATCATGAGG - Intergenic
1022750057 7:33214956-33214978 GGCCAAGGCGGGCGATCACGAGG + Intronic
1022889232 7:34678590-34678612 GCCCAGGAGGGTGGATCATGAGG + Intronic
1023326185 7:39059973-39059995 GGCCAAGGTGGTGGATCATGAGG + Intronic
1024026283 7:45412701-45412723 GGCCAAGGGGGTGGATCACGAGG - Intergenic
1024263689 7:47590441-47590463 GCCGAAGCCGGTGGATCATGAGG + Intergenic
1024583422 7:50819888-50819910 GGCCAAGGTGGTGGATCACAAGG - Intergenic
1025163245 7:56684935-56684957 GGCCAAGTGGGTGGATCACGAGG - Intergenic
1025173300 7:56781316-56781338 GCCAAGGCCGGTGGATCATGAGG - Intergenic
1025602073 7:63010679-63010701 GGCGAGGCAGGTGGATCATGAGG - Intergenic
1025632713 7:63290270-63290292 GCCAAGGTCGGTGGATCATGAGG - Intergenic
1025649987 7:63457915-63457937 GCCAAGGTCGGTGGATCATGAGG + Intergenic
1025716126 7:63957617-63957639 GGCCAAGGCAGTGGATCACGAGG + Intergenic
1026376866 7:69760586-69760608 GGCCAAGGCAGTGGATCATGAGG + Intronic
1026516825 7:71080056-71080078 GGCTAAGGCGGCGGATCATGAGG + Intergenic
1026596705 7:71739049-71739071 GCCGACGGGGGTGGATCATGAGG + Intergenic
1026722696 7:72845670-72845692 GCCCAGGCGGGTGGATCATGAGG + Intergenic
1027133729 7:75609788-75609810 GGCCGAGGCGGAAGATCATGAGG - Intronic
1027144131 7:75682189-75682211 GGCCAGGTGGGTGGATCATGAGG - Intronic
1027164116 7:75822596-75822618 GGCCTAGGCGGTGGATCACCAGG + Intronic
1027485734 7:78759891-78759913 GGCCAAGTGGGCGGATCATGAGG + Intronic
1027523398 7:79237258-79237280 GGCCGAGGCGGTGGATCACGAGG + Intronic
1027618748 7:80456857-80456879 GCCAAGGCCGGTGGATCATGAGG - Intronic
1027707307 7:81550223-81550245 GGCCGAGGCGATGGATCATGAGG + Intergenic
1028692194 7:93665481-93665503 GGCCAGGTGGGTGGATCACGAGG + Intronic
1028996926 7:97110945-97110967 GCCGACGGGGGTGGATCACGAGG - Intergenic
1029247527 7:99213360-99213382 GGCCAAGACGGTGGATCATGAGG - Intergenic
1029266433 7:99345165-99345187 GGCCGAGGCGGTGGATCATGAGG - Intronic
1029305910 7:99619984-99620006 GGCCAAGGCGGTGGGTGAGGAGG + Exonic
1029335366 7:99894428-99894450 GGCCAAGGCAGTGGATTACGAGG + Intronic
1029469200 7:100743255-100743277 GGCCAAGTGGGTGGATCACGAGG - Intronic
1029566987 7:101345452-101345474 GCCCAGGCAGGTGGATCATGAGG + Intergenic
1029588854 7:101493685-101493707 GGCCAAGGTGGAGGATCACGAGG + Intronic
1029678498 7:102090620-102090642 GGCTGAGGTGGTGGATCATGAGG - Intronic
1029890714 7:103926878-103926900 GGCCAAGGGGGTGGATCACGAGG - Intronic
1030001786 7:105072077-105072099 GCCCAGGCGGGTGGATCATGAGG + Intronic
1030091840 7:105864867-105864889 GCCCAGGCGGGTGGATCATGAGG - Intronic
1030121526 7:106114390-106114412 GGCCGAGGTGGCGGATCATGAGG - Intergenic
1030210762 7:106993574-106993596 GGCCAAGGCGGCAGATCATGAGG - Intergenic
1030608234 7:111661151-111661173 GCCGACGTGGGTGGATCATGAGG + Intergenic
1031050714 7:116942148-116942170 GCCCACGCAGGTGGATCATGAGG + Intergenic
1031415988 7:121497202-121497224 GGCGAGGGGGGTGGATCATGAGG + Intergenic
1031531094 7:122878021-122878043 GGCCGAGGCGGTGGATCATGAGG + Intronic
1032171395 7:129587551-129587573 GGCCGAGGGGGTGGATCATGAGG + Intergenic
1032299540 7:130673858-130673880 GGCCAAAGCGATGGATCATGAGG + Intronic
1032852469 7:135806742-135806764 GGCAAGGAGGGTGGATCATGAGG + Intergenic
1032861710 7:135885927-135885949 GGCCGGGGGGGTGGATCACGAGG - Intergenic
1032900703 7:136303712-136303734 GGCCGAGGCGGCAGATCATGAGG + Intergenic
1033177065 7:139134501-139134523 GGCGAAGGCGGCGGATCACGAGG - Intronic
1033189541 7:139264819-139264841 GGCCAAGCGGGTGGATCATGAGG - Intronic
1033733552 7:144200778-144200800 GGCCGAGGCGGGGGATCACGAGG + Intergenic
1033749498 7:144350195-144350217 GGCCGAGGCGGGGGATCACGAGG - Intergenic
1033811032 7:145011311-145011333 GCCGAGGGGGGTGGATCATGAGG + Intergenic
1033897209 7:146088146-146088168 GGCCGAGGTGGGGGATCATGAGG - Intergenic
1034176749 7:149105868-149105890 GGCCGAGGCAGTGGATCACGAGG - Intronic
1034182930 7:149152492-149152514 GGCCGAGGGGGTGGATCACGAGG - Intronic
1034192753 7:149224227-149224249 GGCTGCGGTGGTGGATGATGAGG - Exonic
1034290628 7:149928452-149928474 GGCCGAGGAGGTGGATCATGAGG - Intergenic
1035505236 8:123469-123491 GCCAACGTGGGTGGATCATGAGG - Intergenic
1036247689 8:7133425-7133447 GCCAACGAGGGTGGATCATGAGG - Intergenic
1036276017 8:7352673-7352695 GCCAACGCAGGTGGATCATGAGG - Intergenic
1036533446 8:9620180-9620202 GGCCAAGGCAGCGGATCACGAGG - Intronic
1036723064 8:11195884-11195906 GGCCGAGGTGGCGGATCATGAGG - Intronic
1036744640 8:11397169-11397191 GCCCAGGCGGGTGGATCATGAGG + Intronic
1036840662 8:12118441-12118463 GCCAACGCAGGTGGATCATGAGG + Intergenic
1037162146 8:15786707-15786729 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1037523624 8:19703535-19703557 GCCCAGGCGGGTGGATCATGAGG - Intronic
1037972114 8:23179739-23179761 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1038382030 8:27105326-27105348 GGCCGAGGCGGTGGATCACAAGG + Intergenic
1038790695 8:30665720-30665742 GCCGACGCGGGTGGATCATGAGG - Intergenic
1039358381 8:36846567-36846589 GCCAAGGGGGGTGGATCATGAGG + Intronic
1039495216 8:37975197-37975219 GGCCAAGGCGGAGGATCACAAGG + Intergenic
1039618918 8:38978760-38978782 GCCGAAGGGGGTGGATCATGAGG + Intronic
1039632251 8:39124648-39124670 GGCCAAGGCGGTGGATCACAAGG - Intronic
1040132680 8:43815657-43815679 TGCCAAGGCGGTGGATCACGAGG + Intergenic
1040406537 8:47109361-47109383 GCCGAGGCCGGTGGATCATGAGG - Intergenic
1040414648 8:47185396-47185418 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1040475331 8:47771552-47771574 GGCTGAGGCGGTGGATCACGAGG - Intergenic
1041474906 8:58253636-58253658 GGCCGAGGTGGTGGATCACGAGG - Intergenic
1041955143 8:63550962-63550984 GGCCGAGGCGGCAGATCATGAGG + Intergenic
1042244976 8:66700810-66700832 GGCCGAGGCAGTGGATCACGAGG + Intronic
1042253393 8:66778528-66778550 GGCCGAGGCGGGCGATCATGAGG - Intronic
1042556555 8:70038263-70038285 GGCGAGGTGGGTGGATCATGAGG + Intergenic
1042997797 8:74720082-74720104 GGCCGAGGCGGGGGATCATGAGG - Intronic
1043141646 8:76597606-76597628 GGCCGAGGCAGGGGATCATGAGG + Intergenic
1043544788 8:81302938-81302960 GGCCAAGGCGGGTGATCACGAGG + Intergenic
1043730610 8:83674547-83674569 GCCAACGTGGGTGGATCATGAGG + Intergenic
1044713933 8:95082892-95082914 GGCCGAGGCGGGGGATCACGAGG - Intronic
1045093878 8:98776814-98776836 GGCCGAGGCGGTGGATCACGAGG + Intronic
1046418147 8:113941873-113941895 GGCCGAGGCGGTGGATCACGAGG - Intergenic
1046618324 8:116501322-116501344 GCCGAGGCCGGTGGATCATGGGG - Intergenic
1046903970 8:119553024-119553046 GGCCGAGGTGGCGGATCATGAGG + Intergenic
1047068935 8:121320662-121320684 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1047094185 8:121606535-121606557 GGCCGAGGTGGTGGATCACGAGG - Intergenic
1047660094 8:127024157-127024179 GGCCAAGGAGGTGAATCACGAGG - Intergenic
1047769000 8:128015538-128015560 GGCCAAGGTGGTAGATCACGAGG + Intergenic
1048005776 8:130418313-130418335 GGCCAGGCGGGCGGATCATGAGG + Intronic
1048623714 8:136161771-136161793 GGCCGAGGCAGTAGATCATGAGG - Intergenic
1049817064 8:144609634-144609656 GGCTGAGGCGGTGGATCATGAGG - Intergenic
1049846655 8:144805562-144805584 GGCCGAGGCGGTGGATCACAAGG - Intronic
1050601358 9:7255346-7255368 GCCGAGGGGGGTGGATCATGAGG - Intergenic
1051594725 9:18813197-18813219 GGCTGAGGCGGCGGATCATGTGG - Intronic
1051736500 9:20204977-20204999 GACGAGGGAGGTGGATCATGAGG - Intergenic
1051747083 9:20305338-20305360 GGCCGAGGGGGTCGATCATGAGG - Intergenic
1052124928 9:24763618-24763640 GGCCAAGGCGGTGGATCACCTGG - Intergenic
1052291787 9:26850069-26850091 GGCCAAGGGGGCGGATCACGAGG - Intronic
1052315586 9:27113354-27113376 GCCCAGGCAGGTGGATCATGAGG + Intronic
1052555711 9:30013985-30014007 GGCCGAGGCGGGGGATCACGAGG + Intergenic
1052586520 9:30436079-30436101 GGCCGAGGCAGTGGATCACGAGG + Intergenic
1052897393 9:33760510-33760532 GCCGACGCTGGTGGATCATGAGG + Intronic
1052902921 9:33810027-33810049 GCCCAGGCAGGTGGATCATGAGG + Intergenic
1053047376 9:34931140-34931162 GGCTGAGGCGGTGGATCACGAGG + Intergenic
1053235878 9:36453616-36453638 GGCCAAGGCAGTGGATCACTTGG - Intronic
1053583942 9:39436631-39436653 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1054105523 9:60995375-60995397 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1054749049 9:68885945-68885967 GGCGAGGCCGGCGGATCATGAGG + Intronic
1054791583 9:69261547-69261569 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1054987886 9:71283536-71283558 GGCCAAGGCGGGGGATCACGAGG - Intronic
1055085924 9:72314244-72314266 GGCCAAGGCGGCAGATCATGAGG + Intergenic
1055162539 9:73148078-73148100 GGCCGAGGCGGCGGATCATCAGG - Intergenic
1055513413 9:77016202-77016224 GGCCGCCGCGGAGGATCCTGGGG - Intergenic
1056073296 9:83011317-83011339 GGCCAAAGCGGGTGATCATGAGG + Intronic
1056379210 9:86041881-86041903 GGCTGAGGCGGTGGATCACGAGG + Intronic
1056964398 9:91153911-91153933 GCCCAGGCGGGTGGATCATGAGG - Intergenic
1057085627 9:92207215-92207237 GGCTGAGGTGGTGGATCATGAGG - Intergenic
1057133701 9:92671886-92671908 GGCCAAGGCGGTGGATCATGAGG + Intergenic
1057397823 9:94695787-94695809 GGCCGAGGGGGTGGATCACGAGG - Intergenic
1057499858 9:95588239-95588261 AGCCAAGGCAGTGGATCAAGAGG - Intergenic
1057564244 9:96154030-96154052 GGCCAAGGCGGTGGATCACGAGG - Intergenic
1057583362 9:96307401-96307423 GGCCGAGGTGGCGGATCATGAGG - Intergenic
1057598108 9:96433795-96433817 GCCGACGCGGGTGGATCATGAGG - Intergenic
1057755278 9:97830075-97830097 GGCCGAGGGGGTGGATCATGAGG - Intergenic
1057944716 9:99315526-99315548 GGCAAGGCGGGTGGATCATGAGG - Intergenic
1059156328 9:111992042-111992064 GGCCAAGGCGGGAGATCACGAGG - Intergenic
1059245197 9:112843845-112843867 GCCAACGTGGGTGGATCATGAGG - Intronic
1059290303 9:113217442-113217464 GCCAACGCAGGTGGATCATGAGG - Intronic
1060343323 9:122795856-122795878 GGCAAGGTGGGTGGATCATGAGG + Intergenic
1060439078 9:123621419-123621441 GGCCAAGGGGGTGGATCACTTGG - Intronic
1060990395 9:127845639-127845661 AGCCACCTCTGTGGATCATGTGG - Intronic
1061159919 9:128887875-128887897 GGCCAAGGCGGCGGATCACAAGG - Intronic
1061314870 9:129788704-129788726 GGCCGAGGCGGGGGATCACGCGG - Intergenic
1061562690 9:131416339-131416361 GGCCGAGGCGGCAGATCATGAGG - Intronic
1062636777 9:137495676-137495698 GGCCGAGGCGGCGGACCATGAGG - Intronic
1203603075 Un_KI270748v1:33916-33938 GCCAACGTGGGTGGATCATGAGG + Intergenic
1186833328 X:13412743-13412765 GTCCAGGTGGGTGGATCATGAGG + Intergenic
1187003827 X:15210985-15211007 GGCCGAGGTGGTGGATCACGAGG - Intergenic
1187742847 X:22374946-22374968 GGCCGAGGTGGTGGATCATGAGG + Intergenic
1187787589 X:22910084-22910106 GGCCAAGGCGGGCGATCATGAGG + Intergenic
1187901162 X:24027873-24027895 GGCCAAGGCGGGCGATCATGAGG - Intergenic
1188809134 X:34630936-34630958 GCCCAGGCAGGTGGATCATGAGG + Intronic
1189683189 X:43537426-43537448 GCCCAGGCCGGTGGATCATGAGG - Intergenic
1189819358 X:44855541-44855563 GCCAACGTGGGTGGATCATGAGG + Intergenic
1189819684 X:44858262-44858284 GGCCGAGGCGACGGATCATGAGG + Intergenic
1189965663 X:46370226-46370248 GCCGACGCCAGTGGATCATGAGG + Intergenic
1190295038 X:49021337-49021359 GCCCAAGCCGGTGGATCATGAGG + Intergenic
1190792517 X:53713290-53713312 GTCGAGGCCGGTGGATCATGAGG - Intergenic
1192613619 X:72593573-72593595 GCCCAGGCGGGTGGATCATGAGG - Intronic
1192787670 X:74350946-74350968 GGCCGAGGCAGTGGATCACGAGG + Intergenic
1193301139 X:79890767-79890789 GCCAAGGGGGGTGGATCATGAGG + Intergenic
1193929928 X:87541250-87541272 GCCGAGGGGGGTGGATCATGAGG + Intronic
1194664870 X:96666546-96666568 GCCGACGGGGGTGGATCACGAGG - Intergenic
1194762275 X:97809181-97809203 GGCCGAGGTGGTGGATCATGAGG - Intergenic
1195318490 X:103701505-103701527 GGCCGAGGAGGTGGATCACGAGG + Intergenic
1196270532 X:113705055-113705077 GGGCGCGGTGGTGGATCACGAGG - Intergenic
1196651623 X:118173898-118173920 GGCCAAGGTGGGTGATCATGAGG + Intergenic
1196678052 X:118441190-118441212 GGCCAAGGCAGTGGATCACAAGG - Intronic
1197031253 X:121818731-121818753 GGCCAAGGTGGTGGATCACAAGG - Intergenic
1198811388 X:140539763-140539785 GGCCAAGGCGGTGGAACACGAGG - Intergenic
1198921948 X:141738958-141738980 GCCCAGGTGGGTGGATCATGAGG - Intergenic
1199341329 X:146680593-146680615 GGCCAAGGCAGCGGATCATTAGG + Intergenic
1199764296 X:150929775-150929797 GGCGAGGCCGGTGGATCACGAGG - Intergenic
1199835104 X:151582216-151582238 GGCCAAGGTGGTGGATCACGAGG - Intronic
1200513927 Y:4117854-4117876 GGCCGAGGCGGTGGATCACGAGG + Intergenic
1200609407 Y:5308425-5308447 GGCTGAGGCGGGGGATCATGAGG + Intronic
1200929961 Y:8688198-8688220 GCCCAGGCTGGTGGATCATGAGG - Intergenic
1201143821 Y:11050875-11050897 GCCCAGGTGGGTGGATCATGAGG + Intergenic
1201320717 Y:12695289-12695311 GCCGACGGGGGTGGATCACGAGG + Intergenic