ID: 971244357

View in Genome Browser
Species Human (GRCh38)
Location 4:24914646-24914668
Sequence TTGAGCAAGGCTCAGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 8, 3: 38, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971244357 Original CRISPR TTGAGCAAGGCTCAGCTGGA TGG (reversed) Intronic
900198909 1:1393588-1393610 TGGCGGACGGCTCAGCTGGAGGG + Intronic
902556896 1:17252203-17252225 TGGAGGCAGGCTCAGCGGGATGG + Intronic
902710893 1:18239020-18239042 TTGTTCAAGCCTCAGCTGGGGGG - Intronic
903583734 1:24392299-24392321 TTGTGGAAGTCTCAGCAGGAGGG - Intronic
903655648 1:24947551-24947573 TTGACCAAGGCTGAGCTAGGAGG + Intronic
906120244 1:43384958-43384980 TTGCTCAAGGCTCACCTAGATGG - Intronic
906320742 1:44813805-44813827 TTGGGGCAGGCTCAGCTGGGCGG - Exonic
907526429 1:55056612-55056634 TTGAGCAAGGCTAATGTGAATGG + Intronic
908067421 1:60422164-60422186 TTGGTCTGGGCTCAGCTGGATGG - Intergenic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912439547 1:109687910-109687932 GTGAGCGAGGGTCCGCTGGACGG + Intronic
913066230 1:115258052-115258074 TTGAGCAGAACTCAGCAGGATGG - Intergenic
914245873 1:145885562-145885584 TTGAGGAAGGCAAAGCTGGCGGG + Intronic
914714194 1:150240500-150240522 TTGGGAAAGGCTGAGCTGGCTGG - Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
916407446 1:164511250-164511272 CTGAACAAGTCCCAGCTGGAGGG + Intergenic
916407920 1:164515800-164515822 CTGAACAAGTCCCAGCTGGAGGG - Intergenic
916482807 1:165230613-165230635 TGCAGCAAGGGGCAGCTGGAGGG - Intronic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
916885389 1:169062363-169062385 TTGGGCAGGGCTCAGCTGGTGGG - Intergenic
920189108 1:204180987-204181009 TCGAACAAGGTTAAGCTGGAAGG + Intergenic
920400889 1:205675766-205675788 CTGGGCAGGGCTCAGGTGGAGGG - Intronic
920675843 1:208038303-208038325 TAGAGCAAGGCTTAGCGGGAAGG + Intronic
921192562 1:212723769-212723791 CTGAGCTGGGCTTAGCTGGATGG - Intergenic
921979236 1:221236844-221236866 TTTAGCAGGGCTCAGCTAGATGG - Intergenic
923842336 1:237686595-237686617 TTCACCAAGCCTCAGCTGGGTGG - Intronic
924304022 1:242668428-242668450 TTGAGCTGGGTTCAGCTGGGTGG - Intergenic
1062858246 10:790268-790290 TTGCGCCAGGCCCAGCTGCAGGG + Intergenic
1063090340 10:2860313-2860335 TTGGGCTGGGCTCAGCTGGATGG + Intergenic
1064778548 10:18807619-18807641 TTTAGCGAGGCTCAACTGAATGG + Intergenic
1065066320 10:21968978-21969000 TTGGGCCAGGCTGAGGTGGACGG + Intronic
1068688733 10:59894763-59894785 TAGACCAAGGCCCAACTGGAGGG + Intronic
1068745165 10:60522141-60522163 TTCAGCTGGGCTCAGCTGCAAGG - Intronic
1069563009 10:69444362-69444384 TTGGGCTGGGCTCAGCTGGGTGG + Intergenic
1069842580 10:71348979-71349001 TGGAGCATGGCTGAGCAGGAGGG + Intronic
1069956929 10:72057647-72057669 TTGGGCCAGGATCTGCTGGATGG - Intergenic
1070399270 10:76038869-76038891 TTGGCCAGGGCTCAGCAGGATGG + Intronic
1071013010 10:80961223-80961245 TTGGTAAAGGCTCATCTGGAGGG - Intergenic
1074109629 10:110413466-110413488 TTGGTCAAGGCTCAGCAGGGTGG + Intergenic
1076103500 10:127801724-127801746 TTGGGCAAGGCTCATCAGGAGGG - Intergenic
1076608770 10:131707271-131707293 TTGGGCTGGGCTCAGTTGGATGG - Intergenic
1077359443 11:2134215-2134237 CACAGCAATGCTCAGCTGGAAGG + Intronic
1078480635 11:11672366-11672388 TTGAGCAAGGCGGAGGTGCATGG - Intergenic
1078485867 11:11722798-11722820 TTGAAACAGGCTCAGCTGGAAGG - Intergenic
1079469473 11:20764700-20764722 CTGAGAACTGCTCAGCTGGAGGG + Intronic
1079982003 11:27161003-27161025 TGGGGAAAGGCTCTGCTGGATGG - Intergenic
1080575401 11:33594349-33594371 TTGGGCTGAGCTCAGCTGGATGG + Intronic
1080714929 11:34790909-34790931 TGCAGAAATGCTCAGCTGGATGG - Intergenic
1081639784 11:44744925-44744947 TTTACCCAGGCTCAGCAGGAAGG + Intronic
1081867458 11:46367442-46367464 TTGGCCAAGGCGCAGCTGGCGGG + Intronic
1082779251 11:57273657-57273679 TTGGGCAGGGTTCAGCTGGGTGG - Intergenic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083761789 11:64822699-64822721 TTGACCATGGCTGAGCTGAAAGG - Intergenic
1087181076 11:95143269-95143291 TCGAGTCAGGCTTAGCTGGATGG + Intergenic
1088528216 11:110779318-110779340 TCAGGCAAGGCTCAGCTAGATGG - Intergenic
1088720498 11:112587968-112587990 TTGGGCATGGCTGAGGTGGAGGG - Intergenic
1088757589 11:112898807-112898829 CTGAGCATGGATCAGCTGGATGG - Intergenic
1089768668 11:120786779-120786801 TTGAGAGAGGCTGAGCTGGATGG - Intronic
1090019592 11:123115882-123115904 CTGAGCATGGCTTAGCTGGGTGG + Intronic
1090893681 11:130950364-130950386 GTGGGCAGGGCTCAGTTGGAAGG - Intergenic
1091346091 11:134855219-134855241 TTGAGCAAAGCACAGGTGGCTGG - Intergenic
1093178086 12:15935821-15935843 TTGAGAATGGCTTAGCTGGGTGG + Intronic
1095905922 12:47377899-47377921 ATGAGCAAGGCTGAGCTCCAGGG + Intergenic
1097040806 12:56154819-56154841 TTTAACAAGGACCAGCTGGAGGG + Exonic
1098150575 12:67542288-67542310 TTGAGCTAGAGTCAGCTGCAAGG + Intergenic
1098155545 12:67594070-67594092 CTGAGCAGGGTTCAGCTGGGTGG - Intergenic
1100129787 12:91477561-91477583 ATGAGCAAGGTTTAGCTGGAGGG - Intergenic
1100378463 12:94039635-94039657 TTGGGCATGGCTCAGCTGGGTGG - Intergenic
1102559421 12:113751697-113751719 TTGGGAAAGGCTCAGCTGGGCGG + Intergenic
1102600610 12:114026984-114027006 TTGGGCAGGGCTCAGCTGTGTGG + Intergenic
1102762442 12:115400008-115400030 TGGAGCAGGACTCAGCTGGGTGG + Intergenic
1103208802 12:119151628-119151650 TTGGGCTGGGCTCAGCTGGGTGG + Intronic
1104750291 12:131234109-131234131 TTGGGCAGGGCCCAGCTGGGTGG - Intergenic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1105892128 13:24689419-24689441 GTGAGGAAGCCTCAGCTGGGAGG + Intronic
1106234275 13:27848522-27848544 TTGTGGAAGGTCCAGCTGGAAGG + Intergenic
1108437736 13:50417165-50417187 TTGAGCAGGGCTGAGCAGGCAGG - Intronic
1109104010 13:58225385-58225407 TTGGGCAAGCCTCAGCTGGTTGG - Intergenic
1109182065 13:59225692-59225714 CTGAAAAAGTCTCAGCTGGAAGG + Intergenic
1112385374 13:98934451-98934473 CTGGTCAAGGCTCAGCTGGGTGG - Intronic
1113529573 13:111012304-111012326 TTGGGCTGGACTCAGCTGGATGG - Intergenic
1114618612 14:24081755-24081777 TGGAGCAACGGTCAGCTGGGGGG - Intronic
1115712655 14:36067780-36067802 TTTGCCAAGGCTCGGCTGGATGG - Intergenic
1115806157 14:37054344-37054366 TTGGGCAGGGCTCAGCTGGATGG - Intronic
1117495237 14:56295862-56295884 AAGAGCAAGTCTCAGCAGGATGG + Intronic
1118379288 14:65204651-65204673 CTGAGAAAGGTTCAGCTGGGTGG + Intergenic
1120508563 14:85383687-85383709 CTGAGCTGGGATCAGCTGGATGG - Intergenic
1121877013 14:97462287-97462309 TTGGATAAGGCTCAGCTGGGTGG - Intergenic
1122148260 14:99706991-99707013 TTGAGCAAGGGACAGGTGCAGGG + Intronic
1122855448 14:104557815-104557837 TGGACTCAGGCTCAGCTGGAAGG + Intronic
1122855501 14:104558069-104558091 TGGACCCAGGCTCAGCTGGGAGG + Intronic
1122964852 14:105118190-105118212 TTGGGCTGGGCTCAGCAGGATGG - Intergenic
1124013715 15:25859602-25859624 TTGAGCCACGCTCAGCAGGTTGG - Intronic
1126866359 15:52941462-52941484 CTGGGCAAGCCTCAGCTGGAAGG - Intergenic
1128088325 15:64901352-64901374 TTGGGAAGGGCTCAGCCGGATGG - Intronic
1128478835 15:68020081-68020103 CAGATCAAGTCTCAGCTGGATGG - Intergenic
1130151703 15:81316167-81316189 TTGAGCAAGGCACAAATGCAGGG - Intronic
1131439206 15:92446111-92446133 CTGAGAAGGGCTCACCTGGATGG + Intronic
1131690668 15:94824188-94824210 TGGAGAAAGGGTCAGCTGTATGG + Intergenic
1133455481 16:5938813-5938835 TTGGGCTAGGCTCAGCTGAGTGG - Intergenic
1134894097 16:17869249-17869271 TTTTGGAAGGCTCAGCTGGGAGG - Intergenic
1135609550 16:23854409-23854431 TTGGGCTGGGCTCAGCTGGGTGG + Intronic
1135764262 16:25163936-25163958 TTGGACAGGGCTTAGCTGGATGG + Intronic
1136265284 16:29113429-29113451 AAGAGGAAGGCACAGCTGGAAGG - Intergenic
1138016053 16:53429739-53429761 TTGGGCAGGGCTCAGTGGGAAGG + Intergenic
1138126558 16:54443530-54443552 TTGGAAAAGGCTCAGCTGGGAGG - Intergenic
1138416177 16:56872615-56872637 ATGAGTAAGGCTCACCTGGAGGG - Intronic
1138779988 16:59772211-59772233 TTGAGCTGGGCTCAGCTAGATGG + Intergenic
1140128514 16:72137514-72137536 TCCAGCAAGTCTCAGCTGGGAGG - Intronic
1140447059 16:75038191-75038213 TCAGGCAGGGCTCAGCTGGATGG + Intronic
1141748715 16:85944025-85944047 TTAGGCAGGGCTCAGCTGGCTGG + Intergenic
1141822037 16:86453102-86453124 TTGGGCAGGGATCAGCTGGGTGG - Intergenic
1142341195 16:89523912-89523934 CTCAGGAAAGCTCAGCTGGACGG - Intronic
1143668432 17:8379002-8379024 TTGAGTAAGAATCAACTGGAGGG + Intronic
1144154416 17:12485297-12485319 TGGAGGATGGCTTAGCTGGAAGG - Intergenic
1144626057 17:16845012-16845034 TGGAGCAGGGGTCAGCAGGAAGG - Intergenic
1144880376 17:18427708-18427730 TGGAGCAGGGGTCAGCAGGAAGG + Intergenic
1145151859 17:20516679-20516701 TGGAGCAGGGGTCAGCAGGAAGG - Intergenic
1145323205 17:21778926-21778948 TGTAGCTGGGCTCAGCTGGATGG - Intergenic
1146163227 17:30570950-30570972 TGGAGCAGGGGTCAGCAGGAGGG - Intergenic
1146697093 17:34917721-34917743 TTGAGAAAGTCTCAGAAGGAAGG + Intergenic
1147349638 17:39830819-39830841 TTGGTCATGGCTCAGCTGAAAGG - Intronic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1148457473 17:47818732-47818754 TTGTGCAAGGCTCACTTGCAGGG + Intronic
1149425735 17:56552525-56552547 TTGGGCAGGGCACAGCTGGCTGG + Intergenic
1150509851 17:65739231-65739253 TTGGGCAGGGATCAGCTGGGTGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1153874745 18:9359132-9359154 TTGAGCCTGGATCAGCTGGGTGG + Intronic
1156457219 18:37301567-37301589 TGGAGCAGGGCTGAGCTGGGAGG - Intronic
1156857865 18:41803586-41803608 CTGAGCATGGCTGAGCTGCATGG - Intergenic
1157539824 18:48492874-48492896 TTAAGCTAGGCTCAGTTGGGTGG + Intergenic
1157763025 18:50278169-50278191 TTGAGCAGGACTGAGCGGGATGG + Intronic
1158687809 18:59630479-59630501 TTGGGCAAGGCTCAGCTGGGAGG + Intronic
1160696330 19:486365-486387 TTGAGCAAGGCCTTCCTGGAGGG - Intergenic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1161249562 19:3273200-3273222 TTGGTCTGGGCTCAGCTGGACGG + Intronic
1161486240 19:4537346-4537368 GTGGCCAGGGCTCAGCTGGAAGG + Exonic
1162531533 19:11238856-11238878 ATTACAAAGGCTCAGCTGGAAGG - Intronic
1163322888 19:16585025-16585047 TTGAGACAGGCTCACGTGGAGGG - Intronic
1163769116 19:19180038-19180060 TTGGGCTGGGCTCAGCTGGGTGG - Intronic
1163816045 19:19465144-19465166 TTGAGGAAGGCTAGGCAGGAGGG - Intronic
1164041528 19:21496949-21496971 TTGAGCAAGGTTCAGGCAGAAGG - Intronic
1164618132 19:29678694-29678716 ATGAGCAAAGCTCAGCTGCATGG - Intergenic
1165352705 19:35284827-35284849 TGGAGCCAGGGCCAGCTGGATGG + Exonic
1165967372 19:39594089-39594111 GTGAGAAAGGCTCAGCTGTCAGG - Intergenic
1166514992 19:43439771-43439793 TTTAGCTAGGCTTGGCTGGATGG - Intergenic
1167474222 19:49690866-49690888 AGGAACAAGGCTCAGCTGGGAGG - Intergenic
925146190 2:1584810-1584832 GTGGGCAGGGCTCAGCTGGGTGG - Intergenic
926288040 2:11506295-11506317 TTGACCCTGGCTCAGCTGCATGG - Intergenic
926671979 2:15585270-15585292 TTGGGCAGGGCTTAGCTGGCTGG - Intergenic
929586560 2:43119474-43119496 TTGGGTAGGGCTCAGCTGGTTGG + Intergenic
929924271 2:46196152-46196174 CTGAGCAAGGCTGGGCTGGCGGG + Intergenic
934765544 2:96878221-96878243 TTGGGAATGGCTCAGCTGGTGGG + Intronic
936589594 2:113790575-113790597 TTGAATAGGGTTCAGCTGGATGG + Intergenic
936623876 2:114127499-114127521 TTGAGCAAGGCTCTTCATGAGGG + Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
938602746 2:132859400-132859422 TTGTGGAAAGCTCTGCTGGACGG - Intronic
938759544 2:134411667-134411689 TTTAGAAAGGTTCAGCTGGAGGG - Intronic
939525174 2:143284224-143284246 GTGAGCCAGGCTCAGCTGTATGG + Intronic
940365129 2:152839868-152839890 TTCAGCTGGGCTCAGCTGCATGG + Intergenic
940854102 2:158716395-158716417 TTGAGGAAGGTTCAGCATGAGGG + Intergenic
941001941 2:160211092-160211114 TAGAGTAAGGCTCAGCAGCATGG + Intronic
941318780 2:164028918-164028940 TTCAGAAAGGCTTAGCTGGGAGG + Intergenic
941876227 2:170436226-170436248 ATGAGCAATGCTTAGCTGGGAGG + Intronic
942626210 2:177903319-177903341 TTGAGGAAGGCTGAGTTGGGAGG - Intronic
944492856 2:200275929-200275951 AGGAGCGAGGTTCAGCTGGAAGG - Intergenic
946059692 2:216931283-216931305 TTGAGTAGGGCTCAGCTGGATGG + Intergenic
946076512 2:217078001-217078023 TTGGGCAAGGTTCAGTGGGATGG + Intergenic
946144102 2:217715715-217715737 TTGGGCTGGGCTCAGCTGGGTGG - Intronic
946249092 2:218402208-218402230 TTGAGCAGGGCCCACCTTGAAGG - Exonic
948614965 2:239192547-239192569 TTGAAGAAGACTCAGCTGGCGGG + Intronic
1169075250 20:2756126-2756148 TTGCTCTGGGCTCAGCTGGATGG - Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1170432266 20:16287013-16287035 TTGGGCAGGGCCCAGCTGGATGG - Intronic
1170774739 20:19365359-19365381 TAGAACCAGGCTCACCTGGAGGG - Intronic
1170786791 20:19474204-19474226 TGAAGCAAGGCACAGCAGGACGG + Intronic
1173523006 20:43712863-43712885 TGGAGCAAGGCCCAGCTAGTGGG - Intronic
1173691348 20:44963552-44963574 TTGAGCATGGCTCAGCAGGAAGG - Intergenic
1174269294 20:49355397-49355419 TTGAGAGTGGCTTAGCTGGACGG - Intergenic
1174597302 20:51694069-51694091 TTGCGGACGGATCAGCTGGATGG - Exonic
1178037655 21:28602805-28602827 TTGAGGTAGCCACAGCTGGAGGG + Intergenic
1178153783 21:29827828-29827850 TTGGGCTAGGTTCTGCTGGATGG + Intronic
1178268962 21:31171996-31172018 TTGGGCCAGACTCAGCTGGTTGG - Intronic
1178811216 21:35883232-35883254 TTTAACAAGGTTCAGGTGGAGGG + Intronic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1179574340 21:42298396-42298418 ATGGGGAAGGCTCACCTGGAGGG - Intergenic
1180874417 22:19168564-19168586 CTGCTCAAGGCTCAGCTGGTGGG + Intergenic
1181988403 22:26818097-26818119 TTGAGCTGGGCTCAGCTGGGAGG + Intergenic
1182080930 22:27528166-27528188 TTCCCCAAGGCTCAGATGGAAGG + Intergenic
1182786985 22:32916258-32916280 TTGGGCAGGGCTTAGCTGGGTGG - Intronic
1183662763 22:39231176-39231198 TTGAGAAAGGCTCAGATGGGTGG - Intronic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1184777919 22:46632567-46632589 CTGAGAAGGGGTCAGCTGGAGGG + Intronic
1184884429 22:47333685-47333707 TTGTGCTGGGCTCAGCTGGGAGG + Intergenic
949291940 3:2476989-2477011 TTGAGAATGACACAGCTGGAAGG + Intronic
949850551 3:8416239-8416261 TTGGGAAAGGCTCAGCTGAGTGG - Intergenic
950904179 3:16522686-16522708 TTGGGCAAGGCTTGGCTGGGTGG - Intergenic
950987408 3:17389687-17389709 TTGAGCAGGGCTCAGTAGGATGG - Intronic
952562898 3:34616451-34616473 TTGGGCAGGACTCAGCTGAATGG - Intergenic
954970497 3:54647687-54647709 TGGAGCAAGGCCCTGTTGGATGG - Intronic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956077416 3:65520156-65520178 TTGACTAGGGCTCAGCGGGATGG - Intronic
956170773 3:66431783-66431805 TTGCCCAAGGCTGAGATGGAAGG - Intronic
956424780 3:69122594-69122616 TTAAGCAGGGCTTGGCTGGATGG + Intronic
956768119 3:72501750-72501772 TGGACCGAGGCTCAGCTGGCGGG + Intergenic
956873748 3:73442354-73442376 TTAAGCCAGGCTTAGCTGCAAGG + Intronic
961572728 3:127811916-127811938 TAGTGCTGGGCTCAGCTGGATGG - Intronic
962158408 3:132973662-132973684 ATGAGTAAGGCTGAGCTGAAGGG + Intergenic
962189439 3:133295277-133295299 TTGAGCAAAGCTTTTCTGGAGGG + Intronic
962607473 3:137044733-137044755 TTGCTCAAGGTTCAGCTGAATGG + Intergenic
963260957 3:143190356-143190378 TTGAGCAAGGCTTGGCTGGATGG + Intergenic
967213078 3:187185966-187185988 TTGAGAAACGCTCAGGTGGTAGG + Intergenic
967666305 3:192176200-192176222 TTGAGCAAAGCACAGCTTGAGGG - Intronic
968262989 3:197340047-197340069 CTGAGCCAGGCCCAGCAGGAAGG + Intergenic
970974463 4:22027374-22027396 TTGAGCTGGGTTCAGCTGGGTGG - Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
971246500 4:24933853-24933875 TTGGGGAGGGCTCAGCTGGATGG + Intronic
972246695 4:37252557-37252579 TTGGGCAAGGCTTGGCTGGGTGG + Intronic
972989114 4:44801808-44801830 TTGGGCCAGGCTCAGTTGCAGGG + Intergenic
975618816 4:76275221-76275243 ATGAGCAAGGCTAAGGTGGCAGG - Intronic
976488672 4:85641203-85641225 ACGCGCAAGGCTGAGCTGGAAGG - Intronic
976679146 4:87735486-87735508 TGGAGCAAGGCTCAGCTCTCTGG + Intergenic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
979508632 4:121526842-121526864 TTGAGGTAGGCTCAGCTGAGTGG - Intergenic
981686965 4:147465647-147465669 TTGGGCTAGGCTCAGCTAGGTGG - Intergenic
981855980 4:149293307-149293329 TTGAGTTAGGCTCAACTGGCTGG + Intergenic
982266765 4:153544870-153544892 TTTAATAAGGCTCAGCTGCACGG - Intronic
982759725 4:159266912-159266934 TTAAGCAAGTCTCAGAGGGATGG - Intronic
984415075 4:179447437-179447459 TTTGGCTAGGTTCAGCTGGATGG + Intergenic
984929375 4:184833197-184833219 TTGGGCTAGGTTCAGCTGGGTGG + Intergenic
985868385 5:2534362-2534384 TTGTGCAGGGCTCAGCTGGGTGG + Intergenic
989619641 5:43371699-43371721 TTGGGAGTGGCTCAGCTGGATGG - Intergenic
992380092 5:76228300-76228322 TTGAACAGGGCTGAGCTGTATGG + Intronic
992380113 5:76228466-76228488 TTCAGGAAGGCTCAGCAGGAGGG + Intronic
992432002 5:76718519-76718541 TGGAGGAAGGCTCAGCTTGGTGG - Intronic
992623753 5:78618364-78618386 TTGGGCAAGGAGCAGCTGGGAGG + Intronic
994632987 5:102308766-102308788 TGGAGCTAGGGTCAGCAGGAGGG - Intergenic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
996817121 5:127586855-127586877 CTTAGCAAGGGGCAGCTGGAGGG - Intergenic
998267452 5:140676870-140676892 TCGAGCAAGGCTCAGGTCAAAGG + Exonic
998765949 5:145487528-145487550 TTGAGGAAGGGTTGGCTGGAGGG + Intronic
999498391 5:152123086-152123108 TTAATCATGGCTCAGCTTGAAGG - Intergenic
999953891 5:156679491-156679513 TTGGGCAATGCACAGCTGTATGG + Intronic
1000764801 5:165273838-165273860 TTGGGCAGGGCTCAGTGGGATGG + Intergenic
1003011713 6:2433239-2433261 TTGTCCCAGGCTCAGCTGGGTGG + Intergenic
1003506274 6:6742939-6742961 TTCATCCAGGCTCTGCTGGAAGG + Intergenic
1003682427 6:8269271-8269293 TTGGGCAGGGTTCAGTTGGAAGG + Intergenic
1004762183 6:18679292-18679314 TTAAACAGGGCTCAGCTGGGTGG - Intergenic
1007989228 6:46237996-46238018 TTGGGCCAGGCTCAGGGGGAAGG - Intronic
1008800215 6:55359534-55359556 TTGGACTTGGCTCAGCTGGATGG + Intronic
1012960026 6:105612574-105612596 TTGACCAAGACCCAGCTGGGAGG + Intergenic
1013412874 6:109897426-109897448 CTGAGTGAGGCTAAGCTGGAGGG - Intergenic
1015245104 6:131065974-131065996 TCAAGCAATGCTCAGCTGGGAGG + Intergenic
1017697329 6:157030090-157030112 TTGGGCTGGGCTCAGCTGGGTGG + Intronic
1017819532 6:158039356-158039378 TGGAGCAAGGCTCAGCCTGCAGG + Intronic
1023482560 7:40649959-40649981 CTGAGCATGGCTTAGTTGGATGG + Intronic
1023552805 7:41387891-41387913 TTAAGCAGGGCTCTGCTGGATGG + Intergenic
1023761007 7:43465306-43465328 TTGAGCTGAGCTCAGCTGGGTGG + Intronic
1024220380 7:47282230-47282252 TTGGGTATGGCTCAGCTGCATGG - Intronic
1026304316 7:69126807-69126829 GTGAACTGGGCTCAGCTGGATGG - Intergenic
1028518954 7:91707755-91707777 TTGGCCAAGGCAGAGCTGGAAGG + Intronic
1030165614 7:106552214-106552236 TTGAGCCAGGCCCAGGTGGTAGG + Intergenic
1030528945 7:110688183-110688205 TTCAGAAGGGCTCAGCTGGGCGG - Intronic
1030568994 7:111197640-111197662 TTAAGGAAGTATCAGCTGGAAGG + Intronic
1031770324 7:125833461-125833483 TTGAGCACAGCTCAGCTGGTGGG + Intergenic
1032619114 7:133509485-133509507 TTAAAGAAGGCTCAGCTGGAAGG + Intronic
1032678962 7:134162199-134162221 CTGAGCCAGGCTCAGCTGGGAGG + Intronic
1033311432 7:140264748-140264770 TGGGGCCTGGCTCAGCTGGAGGG + Intergenic
1033509026 7:142036075-142036097 TTAAGCAAGGTTCAGTTGGGAGG + Intronic
1036759047 8:11494314-11494336 TTCAGAAGGGCTCGGCTGGAGGG + Exonic
1039222851 8:35354775-35354797 TTGGGAAGGGCACAGCTGGATGG + Intronic
1039771642 8:40693836-40693858 TTGATCAAAGGGCAGCTGGAGGG + Intronic
1040530009 8:48259072-48259094 TTGGGCTGAGCTCAGCTGGATGG - Intergenic
1041447175 8:57965065-57965087 ATGAGGAAGGGTCAGCTGGCAGG + Intergenic
1042332899 8:67599805-67599827 TGGAGAAATGCTCAGCTAGAGGG + Intronic
1042391149 8:68236372-68236394 TTGTGCAAGGCACAGCTGTTGGG + Exonic
1042553027 8:70011258-70011280 TTGAGCATGTATCACCTGGAGGG + Intergenic
1044391118 8:91652688-91652710 ATGAGCAAGACTGTGCTGGAGGG - Intergenic
1044840484 8:96332887-96332909 TGAACAAAGGCTCAGCTGGAGGG + Intronic
1045497943 8:102723971-102723993 TTGGGCTAGGCTCAGCTGGGTGG - Intergenic
1047674108 8:127181415-127181437 TTGGGCTAGGATCAGCAGGATGG + Intergenic
1047956746 8:129982248-129982270 TTGGACAGGGCTGAGCTGGAGGG - Intronic
1050114779 9:2252595-2252617 TTGGGCTAGGCTCAGGTAGATGG + Intergenic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1053105249 9:35403342-35403364 TGGAGGAGGGCTGAGCTGGAGGG - Intronic
1053343115 9:37355816-37355838 TTGTGCAAGGGTCAGCTGTGTGG + Intronic
1054715646 9:68555635-68555657 TTGGGCTAGTCACAGCTGGAAGG + Intergenic
1056078520 9:83065265-83065287 TTGGGCAGGGCTCAGCTAGGTGG + Intergenic
1056799972 9:89684173-89684195 GTCAGGAAGGCTCAGCTGGGTGG - Intergenic
1056949214 9:91028685-91028707 TTGGGAAGGGCTCAGCTGGGCGG - Intergenic
1058372168 9:104282040-104282062 GTGAGGAAGGCTCAGATGCAAGG - Intergenic
1058532266 9:105917774-105917796 TTGGGCTAGGCTCAGCTGTGTGG + Intergenic
1059483910 9:114612474-114612496 TGGTGCAGGGCTGAGCTGGATGG + Intronic
1061232898 9:129325248-129325270 TTCAGCAAGGCTCAGCTTGGTGG + Intergenic
1061501429 9:131005013-131005035 TTGACCAAGGTACAGGTGGAAGG - Intergenic
1062014500 9:134284398-134284420 GGGAGCCAGGCTCAGCGGGAGGG - Intergenic
1062406529 9:136399515-136399537 GTGAGCAATGATCAGCAGGAAGG + Intergenic
1185465657 X:352980-353002 TGGAGCAGGGCTCTGCTGGGGGG + Intronic
1186076769 X:5888025-5888047 TTTAGCAAATTTCAGCTGGAGGG - Intronic
1186530121 X:10286887-10286909 TTGGGCAGGGCTCAGATGGATGG + Intergenic
1187016308 X:15332915-15332937 GTGAGCTAGGCTCAGCTGGGTGG - Intronic
1187209644 X:17216761-17216783 TTGAACTGGGCTCAGCTGGATGG + Intergenic
1187211709 X:17238457-17238479 TTGGGGTAGGCTCAGCTGGGTGG + Intergenic
1187411206 X:19051883-19051905 TTGGGCAGAGCTCAGCAGGAGGG - Intronic
1187676375 X:21720439-21720461 TTTAGCATGGCTTAGCTGGGTGG - Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189133132 X:38521033-38521055 TTGAGCAAGACTCAGTGGAATGG - Intronic
1189914362 X:45842215-45842237 TTGGGCAGGACTCAGCTGGATGG - Intergenic
1190093753 X:47462532-47462554 CAGAACAAGGATCAGCTGGAGGG - Intronic
1190093769 X:47462621-47462643 GTGAGCCAGGAACAGCTGGAAGG - Intronic
1195387322 X:104325394-104325416 TTGTGAAAGTCTCAGCTGCAAGG - Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1201518514 Y:14845949-14845971 TTTAGCAAATTTCAGCTGGAGGG + Intergenic
1201893163 Y:18964786-18964808 TTGGACTAGGCTCAGCTGGGTGG - Intergenic