ID: 971244358

View in Genome Browser
Species Human (GRCh38)
Location 4:24914650-24914672
Sequence CTAGTTGAGCAAGGCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971244358 Original CRISPR CTAGTTGAGCAAGGCTCAGC TGG (reversed) Intronic
902868887 1:19300495-19300517 CTGTTAGAGCAGGGCTCAGCAGG - Intergenic
906832561 1:49048545-49048567 CTATTTGAGGAGGGCTCAGCAGG + Intronic
912159173 1:106960122-106960144 CTAAATGTGCAAGGATCAGCTGG + Intergenic
915350074 1:155218722-155218744 CTCTTTGAGCAAGGCACAGATGG - Intergenic
915353472 1:155240960-155240982 CTCTTTGAGCAAGGCACAGATGG - Intronic
915579351 1:156804179-156804201 CTAGTTGTGCAACCTTCAGCAGG - Intergenic
918010451 1:180581700-180581722 CTAGTTGAGCAATTCTAGGCTGG - Intergenic
919808951 1:201397244-201397266 CTGGGTGAACAAGCCTCAGCGGG - Intronic
919986258 1:202677638-202677660 CAGTTTGAGCAGGGCTCAGCTGG - Intronic
920848564 1:209613106-209613128 CAAGTGGAGCAGGGCTTAGCAGG + Exonic
921361320 1:214333306-214333328 CTAGCAGAGCAAGGCCCTGCTGG - Intronic
924304024 1:242668432-242668454 CAAGTTGAGCTGGGTTCAGCTGG - Intergenic
1064927502 10:20585333-20585355 GTAGTTGAGAGAGGCTCAGAGGG - Intergenic
1072587467 10:96795461-96795483 CCAGGTGATCAAGGCTCAGTCGG - Intergenic
1073553179 10:104422494-104422516 CAATTTGAGCTGGGCTCAGCTGG + Intronic
1079314029 11:19392357-19392379 CAATTTGAGCAGGGCTCAGCAGG + Intronic
1080767109 11:35307211-35307233 CTTCTAGAGCCAGGCTCAGCTGG + Intronic
1080933743 11:36840081-36840103 CTAGCTGAACAAAGATCAGCAGG + Intergenic
1083271717 11:61576207-61576229 CTAGTTGGACAGGGCCCAGCAGG + Intronic
1083403890 11:62443566-62443588 CAAGATGAGCAAGACCCAGCCGG - Intronic
1086393047 11:86385489-86385511 CTAGTAGAGCAAGTGACAGCTGG + Intronic
1086959131 11:92964656-92964678 GTAGTTGAGCCAGGCTGGGCGGG - Intergenic
1090619301 11:128547566-128547588 CTACTTCAGCAAGTCTCAGGAGG + Intronic
1090953051 11:131490456-131490478 CAATTTGTGCAAGGCTCAGCAGG + Intronic
1097983418 12:65757515-65757537 CAATTTGGGCAAGGCTCAGCAGG - Intergenic
1100781200 12:98028502-98028524 CAATTTGAGTTAGGCTCAGCTGG + Intergenic
1101207902 12:102507280-102507302 CAATCTGGGCAAGGCTCAGCAGG + Intergenic
1101409547 12:104457288-104457310 AGAGCTGAGCAAGGCTCAGAGGG - Exonic
1101850512 12:108398292-108398314 CTAATGGAGAAAGGCTCAGTTGG - Intergenic
1102927343 12:116836279-116836301 CCAGGTGAGCAGGGCTCAGGCGG + Exonic
1103248257 12:119477016-119477038 CAATTTGAGTAAGGCTCAGAGGG + Intronic
1105892126 13:24689415-24689437 CCAGGTGAGGAAGCCTCAGCTGG + Intronic
1107972558 13:45657734-45657756 CAATTGGAGCAAGGCTCAGCTGG - Intergenic
1111174422 13:84575087-84575109 CTAGTTTAGAAAGGAACAGCAGG - Intergenic
1116031703 14:39580831-39580853 TTAGTTGATCAAGGGTCAGAAGG - Intergenic
1120491500 14:85184168-85184190 CTACTTTAGCAAGCCTCAACTGG - Intergenic
1121014164 14:90538350-90538372 TTAGTTGGGAAAGGCTCAGCAGG + Exonic
1121826941 14:97017864-97017886 CAATTTGGGCAGGGCTCAGCTGG - Intergenic
1122874668 14:104658460-104658482 CAATTTGGGCAGGGCTCAGCAGG - Intergenic
1124397778 15:29319750-29319772 CTAGGTGAGCAGATCTCAGCCGG - Intronic
1124794495 15:32763739-32763761 GAATTTGAGAAAGGCTCAGCTGG - Intergenic
1129413969 15:75364553-75364575 CTAGCTCAGCCCGGCTCAGCTGG + Exonic
1130909389 15:88260754-88260776 CTACTTCTGCAAGTCTCAGCTGG + Intergenic
1134021619 16:10925001-10925023 TCATTTGAGCAGGGCTCAGCGGG + Exonic
1136784273 16:32925494-32925516 CTCGCTGAGCAAGGAGCAGCGGG + Intergenic
1136885511 16:33928312-33928334 CTCGCTGAGCAAGGAGCAGCGGG - Intergenic
1137624760 16:49900619-49900641 TTAGTTGAGCAAGACCGAGCAGG + Intergenic
1137932290 16:52600557-52600579 CTAGTTTAGCTGGGCCCAGCTGG + Intergenic
1140042234 16:71415808-71415830 CTAGTTCATCAAGGCCCTGCTGG + Intergenic
1140435437 16:74943118-74943140 GTAGTTGAGCATGGCACTGCTGG + Intronic
1141446661 16:84063176-84063198 TCACTTGAGCCAGGCTCAGCTGG - Intronic
1143301438 17:5913533-5913555 GGAGTTGGGCAGGGCTCAGCTGG + Intronic
1143439036 17:6953761-6953783 CTGTTTGAGGAAGGCTCAGGAGG + Intronic
1146555277 17:33817764-33817786 CGATTTGGGCAGGGCTCAGCAGG + Intronic
1158227313 18:55214719-55214741 CTAGGTGAGCTGGGCTCAGTGGG - Intergenic
1158306865 18:56115645-56115667 CAAGTTGAGGCAGGCTCATCAGG - Intergenic
1158687807 18:59630475-59630497 GGATTTGGGCAAGGCTCAGCTGG + Intronic
1162973795 19:14196765-14196787 CTAGTTCAGCAAGGTCCTGCTGG + Intronic
1166225005 19:41389578-41389600 CTAATTAAGCAAGTCTGAGCTGG + Intronic
925816340 2:7754581-7754603 CTAGTTGAGCTCAGTTCAGCTGG + Intergenic
926624581 2:15080577-15080599 GAACTTGAGCAAGGCTCAGCTGG + Intergenic
927380379 2:22472905-22472927 TAAGTTGAGCTGGGCTCAGCTGG + Intergenic
928084424 2:28336978-28337000 CTGGTAGAGCCAGGCTCAGTAGG + Intronic
928199536 2:29238686-29238708 CTGGTTGGGCAAGGCATAGCAGG - Intronic
929441686 2:41970239-41970261 CAATTTGAGCAGGGCTCAGTGGG + Intergenic
929530175 2:42745680-42745702 AAAGTTGAGAAAGTCTCAGCTGG - Intronic
929636362 2:43525709-43525731 CAATTTGGGCAGGGCTCAGCTGG - Intronic
929876936 2:45804460-45804482 CTGGTTGAGCAAGGCAGATCAGG + Intronic
932011868 2:67986565-67986587 CAAGTTGAGAAGGGCTCAGCGGG - Intergenic
933275369 2:80278344-80278366 CAACTTGAGCTAGGCTCAGCTGG + Intronic
936398498 2:112148560-112148582 CAATTTGAGCCAAGCTCAGCTGG + Intronic
936986213 2:118313514-118313536 CAATTTGAGCATGGCTCCGCAGG + Intergenic
940357573 2:152762251-152762273 GTAGTTCAGCCAGGCTCAGTGGG + Intergenic
941140336 2:161772938-161772960 GTAGTTCAGCAAGAATCAGCTGG + Intronic
945307224 2:208269759-208269781 CAAGTTTAACAAGGATCAGCTGG - Intronic
946308678 2:218871102-218871124 CGAGTTGTGCCAGGCTGAGCCGG + Exonic
946341274 2:219070931-219070953 CTAGTTGTGGAAGGCAGAGCTGG - Intergenic
1169346246 20:4830078-4830100 CTATTTGGGCTAGACTCAGCTGG - Intergenic
1169563732 20:6829769-6829791 TTATTTGAGGAAAGCTCAGCTGG + Intergenic
1171245784 20:23608587-23608609 CAAGCTGGGCCAGGCTCAGCGGG + Intergenic
1173691349 20:44963556-44963578 CAATTTGAGCATGGCTCAGCAGG - Intergenic
1175817803 20:61892756-61892778 CAATTTGGGCTAGGCTCAGCTGG + Intronic
1176130756 20:63495837-63495859 CCAGGTGAGCAGGGCACAGCAGG - Exonic
1178144124 21:29718114-29718136 ATAGTTTAGCATGGCTCAGGAGG - Intronic
1181988401 22:26818093-26818115 CAAGTTGAGCTGGGCTCAGCTGG + Intergenic
950987409 3:17389691-17389713 CAACTTGAGCAGGGCTCAGTAGG - Intronic
953788545 3:45929280-45929302 CTAGAGGAGGAAGGCTCAGTAGG + Intronic
959500815 3:107104009-107104031 CAATCTGAGCAGGGCTCAGCTGG - Intergenic
959579158 3:107966618-107966640 CTAGATGAACAGGGGTCAGCCGG - Intergenic
963599307 3:147364118-147364140 CAATTTGAGCAATGTTCAGCAGG - Intergenic
964123432 3:153210346-153210368 CGAAATGAGCGAGGCTCAGCAGG + Intergenic
968152503 3:196348262-196348284 ATTGTTGAGCAAGGGGCAGCTGG - Exonic
968477144 4:817206-817228 AACGTTAAGCAAGGCTCAGCAGG + Intronic
968528547 4:1077675-1077697 CTAGTGCAGCAAGGGACAGCTGG + Intronic
968610537 4:1554867-1554889 CTAGCAGAGCAAGGCTGGGCCGG - Intergenic
970366440 4:15363515-15363537 CTAGAAGAGAAAGGCTCAGGTGG - Intronic
970657597 4:18248783-18248805 CAACTTGGGCCAGGCTCAGCTGG + Intergenic
970905288 4:21208797-21208819 ATAGTTCAGCATGGCTCAGGAGG + Intronic
971244358 4:24914650-24914672 CTAGTTGAGCAAGGCTCAGCTGG - Intronic
974079900 4:57201212-57201234 CTAGTTGATCAGGTCTCACCGGG - Intergenic
974850425 4:67398090-67398112 CAATTTGGGCTAGGCTCAGCTGG + Intergenic
975612500 4:76215863-76215885 CATTTTGAGCAGGGCTCAGCAGG - Intronic
975862586 4:78693124-78693146 CCATTTGGGCAGGGCTCAGCAGG - Intergenic
976362190 4:84193320-84193342 CCATTTGAGCTGGGCTCAGCTGG - Intergenic
976904980 4:90226220-90226242 CAATCTGAGCAAGGCTCAGCTGG - Intronic
978540653 4:109813312-109813334 CTAGTTGAACAAGGATCTTCAGG + Intergenic
978561918 4:110042614-110042636 CAGGTTCAGCAAGTCTCAGCAGG - Intergenic
979674003 4:123391466-123391488 TAAGGTGAGCAGGGCTCAGCAGG + Intergenic
980094764 4:128477906-128477928 CAATTTAAGCAAGGCTCAGCAGG - Intergenic
983554121 4:169044887-169044909 CAATTTGGGCAGGGCTCAGCAGG + Intergenic
983815851 4:172126522-172126544 CTTGCTCAGCAAGGATCAGCTGG + Intronic
986674945 5:10175865-10175887 ATAGTTGAGCTAGGCTCACCTGG + Intergenic
988318388 5:29660775-29660797 CTAGTTAAGAAGTGCTCAGCTGG - Intergenic
990442638 5:55861863-55861885 ATAGAAGAGCAAGGCTGAGCAGG - Intronic
991519682 5:67482094-67482116 CAACTTGAGCAGGGCTCAGTGGG + Intergenic
995845849 5:116493081-116493103 CTACTGGAGCATGTCTCAGCAGG + Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996126647 5:119733214-119733236 CTAGGTGTGCAAGGGTAAGCAGG + Intergenic
996514017 5:124349926-124349948 CAAGTTGAACTAGGCTCAGCTGG + Intergenic
998531830 5:142892219-142892241 CTAGATGAGGATGGCTCTGCAGG + Intronic
999117632 5:149177719-149177741 ATATTTGAGCAAAGCTCAGTGGG + Intronic
999570000 5:152909183-152909205 CTACATGTGCAAGGCTGAGCAGG - Intergenic
1004188471 6:13443359-13443381 TTAGTTGATAAAGGCGCAGCAGG + Intronic
1012960024 6:105612570-105612592 CTAGTTGACCAAGACCCAGCTGG + Intergenic
1018167388 6:161111015-161111037 CTAGTTCAGCATGGCTAAGAAGG + Intronic
1020239630 7:6383551-6383573 TTAGCTGAGAAAGGCTCAACCGG - Intronic
1023036416 7:36135461-36135483 CTACTTGAGCAAGCCTGAGAGGG - Intergenic
1028639948 7:93030427-93030449 TTAGGTGGGCAAGGCTCAGCAGG - Intergenic
1030712004 7:112760162-112760184 CAAGTGAAGCAAGGCTCAGCAGG - Intergenic
1031770322 7:125833457-125833479 GTTGTTGAGCACAGCTCAGCTGG + Intergenic
1032580651 7:133100152-133100174 CAATTTGAGCAGAGCTCAGCAGG - Intergenic
1032678960 7:134162195-134162217 CAATCTGAGCCAGGCTCAGCTGG + Intronic
1033932739 7:146544749-146544771 CTACTAGAGCCCGGCTCAGCAGG - Intronic
1035409478 7:158627587-158627609 CTAGACCAGCAGGGCTCAGCTGG - Intergenic
1038068528 8:23988161-23988183 CAAGTTGGGCCAGGCTCAGCTGG - Intergenic
1044475602 8:92621668-92621690 CCATTTGAACAGGGCTCAGCAGG - Intergenic
1045497945 8:102723975-102723997 CAATTTGGGCTAGGCTCAGCTGG - Intergenic
1046501929 8:115088859-115088881 CTAGTTTATCAAGGATCAGCTGG + Intergenic
1046780895 8:118213559-118213581 CAATTTGGGCAAGGCTTAGCAGG - Intronic
1047003999 8:120600899-120600921 CAAGATGAGCAAGGCTGGGCTGG - Intronic
1049782926 8:144437008-144437030 CTAGGTGAGCAAGGGACAGAAGG - Exonic
1052647641 9:31255762-31255784 CTATTTGAGCAGGGCTTTGCAGG - Intergenic
1056109750 9:83383246-83383268 GGATTTGAGCAGGGCTCAGCTGG - Intronic
1060862037 9:126962409-126962431 CTCGCTGTCCAAGGCTCAGCTGG - Intronic
1062527291 9:136983114-136983136 CTCTTTGATCCAGGCTCAGCAGG + Exonic
1062685863 9:137813105-137813127 GCAGATGAGCAAGGCTCTGCAGG + Exonic
1189247387 X:39574130-39574152 CGATTTGGGCAGGGCTCAGCAGG - Intergenic
1193403389 X:81072595-81072617 CTAATTGAGGAAGGGTCAGGGGG - Intergenic
1197439819 X:126474916-126474938 ACAGTTCAGCAAGGCTGAGCAGG - Intergenic
1198973027 X:142302765-142302787 CTACTAGAGCAATGCTAAGCAGG - Intergenic
1200167890 X:154049960-154049982 CAAGCTGAGCAAGGAGCAGCAGG + Intronic
1200958070 Y:8971408-8971430 CTAGGGGAGAAAGGCTCATCAGG - Intergenic