ID: 971246446

View in Genome Browser
Species Human (GRCh38)
Location 4:24933200-24933222
Sequence TTGTATGTACTTAAATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971246439_971246446 11 Left 971246439 4:24933166-24933188 CCCTGCTTGCATGTGCTATCCTA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 290
971246438_971246446 12 Left 971246438 4:24933165-24933187 CCCCTGCTTGCATGTGCTATCCT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 290
971246440_971246446 10 Left 971246440 4:24933167-24933189 CCTGCTTGCATGTGCTATCCTAA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 290
971246442_971246446 -8 Left 971246442 4:24933185-24933207 CCTAAAAGTGAGGACTTGTATGT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971246446 Original CRISPR TTGTATGTACTTAAATGGGA GGG Intronic
900702428 1:4056543-4056565 TTGAATGTACTGAAAGGGCAGGG + Intergenic
903401067 1:23049214-23049236 ATGTAATTACTTAAATGGTATGG + Intronic
908443153 1:64175335-64175357 TCGTATGTACTGGTATGGGAAGG - Intronic
909927172 1:81451217-81451239 TTATATCTAATTAATTGGGAAGG - Intronic
910606218 1:89087654-89087676 TTGTAGGTACCTAAACTGGAAGG + Intergenic
911194769 1:94983013-94983035 TAGTATGTACTCAAATTGGGGGG - Exonic
915924810 1:160008510-160008532 TTGTAAGTTCTTAAAGGGAAGGG - Intergenic
917774004 1:178313680-178313702 TTTTAGGGATTTAAATGGGAGGG + Intronic
917912607 1:179666264-179666286 TTGTAAGTATTGAAATGGAAAGG - Intronic
919950644 1:202360206-202360228 TGGTATGTACTTCCATGAGAAGG + Intronic
921538318 1:216380228-216380250 TTCACTGTAGTTAAATGGGAAGG + Intronic
922268613 1:224012083-224012105 TGGAATGGACTTGAATGGGATGG + Intergenic
922880874 1:228979485-228979507 TTGTAGATACCCAAATGGGAGGG + Intergenic
923115603 1:230934593-230934615 TTGTTTCTACTTAAATAGAATGG - Intronic
923862516 1:237905658-237905680 TTTTGTGTATTTAAAAGGGAAGG + Intergenic
924860639 1:247917260-247917282 TTGTGTGTAGTTTAATAGGATGG - Intergenic
1063983913 10:11480642-11480664 TTTTATTTACTTAATTGAGAAGG - Intronic
1064404043 10:15045269-15045291 TTTTATGTACTTCAATTAGAAGG + Intronic
1064886238 10:20115502-20115524 TTTTATGTACTAACATGTGAAGG - Intronic
1065756440 10:28935367-28935389 TTGGAAATACTTAAATTGGATGG + Intergenic
1066209207 10:33220527-33220549 ATGTATTTACTAAAATGGAAAGG + Intronic
1066736442 10:38484454-38484476 TTGAATGTACTCAAATCGAATGG + Intergenic
1066736450 10:38484524-38484546 TTGAATGTACTCAAATGGAATGG + Intergenic
1066736462 10:38484609-38484631 TTGAATGTACTCAAATGGAATGG + Intergenic
1066737345 10:38491421-38491443 TTGAATGGACTCAAATGGAATGG + Intergenic
1066737366 10:38491591-38491613 TTGAATGTACTCAAAAGGAATGG + Intergenic
1066737578 10:38493204-38493226 TGGTATGTACTCGAATGTGATGG + Intergenic
1066738328 10:38498572-38498594 TGGAATGGACTTAAATGGAATGG + Intergenic
1066740389 10:38514347-38514369 TGGTATGGACTCAAATGGAATGG + Intergenic
1066740627 10:38516156-38516178 TTGAATGGACATAAATGGAATGG + Intergenic
1066741243 10:38520794-38520816 TGGAATGTACTTGAATGGAATGG + Intergenic
1066765158 10:38795962-38795984 TGGAATGGACTCAAATGGGAAGG - Intergenic
1066767096 10:38812613-38812635 TGGAATGTACTTGAATGGAATGG - Intergenic
1066768366 10:38823381-38823403 TGGTATGTAATTGAATGGAACGG + Intergenic
1066768458 10:38824118-38824140 TTGGATGGAATTAAATGGAATGG + Intergenic
1066771013 10:38845823-38845845 TTGAATGTAATTAAATGAAATGG + Intergenic
1066772195 10:38855350-38855372 TGTTATGTACTCAAATGGAATGG + Intergenic
1066773257 10:38864359-38864381 TGGAATGTACTTGAATGGAATGG + Intergenic
1066777085 10:38895914-38895936 TTGTATGAACTGGAGTGGGATGG + Intergenic
1066938667 10:41864940-41864962 TTGAATGCAATTAAATGGAATGG + Intergenic
1066968799 10:42296391-42296413 TTGAATGAACTCGAATGGGATGG - Intergenic
1066969238 10:42299658-42299680 TTGAATGGACTCGAATGGGATGG - Intergenic
1066969380 10:42300731-42300753 TTGAATGGACTTGAATGGAATGG - Intergenic
1066969590 10:42302273-42302295 TTGAATGTACTCAAATGGAATGG - Intergenic
1066969861 10:42304220-42304242 TGGAATGTACTTGAATGGAATGG - Intergenic
1066969954 10:42304865-42304887 TGGTATGGACTTGAATGGAATGG - Intergenic
1066970758 10:42310371-42310393 TGGAATGGACTTGAATGGGATGG - Intergenic
1066971963 10:42319464-42319486 TTGAATGTACTTGAATGGAATGG - Intergenic
1066971966 10:42319494-42319516 TTGTATGTACTTGAATGGAAAGG - Intergenic
1068522040 10:58087565-58087587 TTGTACCTACTTAAAGGTGAGGG - Intergenic
1068918778 10:62461571-62461593 TTGTATTTATTGGAATGGGAGGG - Intronic
1070063022 10:73004302-73004324 TTATATGGACTTAAGTGGTATGG + Intergenic
1071145918 10:82571330-82571352 TTGTATGTCTTTAAATGCGAGGG - Intronic
1071826783 10:89333467-89333489 TTGTATGTGTGTAAATGTGAAGG + Intronic
1072864079 10:99040227-99040249 TTGTATGTATTTCAATTGAATGG + Intronic
1074699066 10:116077288-116077310 CTGTATGTGCTTAATTGAGAGGG + Intronic
1076182379 10:128420266-128420288 TTTTAAGTAATTAAATGGGTTGG + Intergenic
1078012550 11:7584027-7584049 TTGTATGCACATGAATGGCAGGG - Intronic
1078304118 11:10165681-10165703 TATAATGTACTTAAATGAGATGG + Intronic
1080271786 11:30458285-30458307 TTCTTCGTACTTAAATGGCAAGG - Intronic
1087556677 11:99730060-99730082 TTGAATTTAATTAAATGAGAGGG + Intronic
1094237825 12:28188916-28188938 ATGTAAGTACATCAATGGGAAGG + Intronic
1096083026 12:48845540-48845562 TTGTATGTTATTACATGGGAAGG - Intronic
1097293187 12:57937134-57937156 TTGGTTGTCCTTAAATGGGTAGG - Intergenic
1098520281 12:71427890-71427912 GTGTTCGTACTTAAATGGCAGGG - Intronic
1099327434 12:81236986-81237008 TTTTCTCTACTTAAAAGGGAGGG + Intronic
1099685096 12:85875100-85875122 TTGTATTAACTTAAATGGCATGG - Intronic
1100451841 12:94714161-94714183 TTGAATATATTTAAATGGGATGG - Intergenic
1100686167 12:96988228-96988250 TTGTATCTTCTAAAATGGGAAGG + Intergenic
1101450851 12:104777558-104777580 TAATACATACTTAAATGGGAAGG + Intergenic
1102841656 12:116131618-116131640 ATGTATATACATAAATGTGAAGG - Intronic
1105021355 12:132818561-132818583 TTGGTTTTACTTAAATGGAAAGG - Intronic
1105478495 13:20750419-20750441 TTGCATGTTCTTATATGCGAAGG - Intronic
1105867991 13:24478176-24478198 GTGTATGGACTTACATGAGAAGG - Exonic
1107463831 13:40630816-40630838 TTTTAATTTCTTAAATGGGAAGG + Intronic
1113036905 13:106060806-106060828 TTATGTGTAGTAAAATGGGATGG - Intergenic
1115190959 14:30746751-30746773 CTGTATGTACTAAGATGGCATGG + Intergenic
1115432184 14:33332106-33332128 TTGTATTACCTTAAATGGGGAGG - Intronic
1116834123 14:49752573-49752595 TTGTAAGTAATGAGATGGGATGG + Exonic
1119535376 14:75398844-75398866 TTGTAGGTCCTGAAATGGAAAGG - Intergenic
1120016248 14:79477125-79477147 TTTAATGTACATAGATGGGATGG + Intronic
1120508916 14:85388792-85388814 TTGTATTTTTTTAAAAGGGAGGG - Intergenic
1120778785 14:88466709-88466731 TGGGATGTGCCTAAATGGGATGG + Exonic
1121481135 14:94275583-94275605 TGGAAAGTACTTAAGTGGGAAGG - Intronic
1121809481 14:96869634-96869656 TTATATGTTCTTAAAAGGTATGG - Intronic
1202875011 14_GL000225v1_random:199036-199058 TTGAATGGACTCAAATGGAATGG + Intergenic
1125383756 15:39114850-39114872 ATCTATGTACTTAAATGGTGGGG - Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1125634170 15:41173281-41173303 TTGTATGTATTAAAAGCGGATGG + Intergenic
1128916079 15:71563796-71563818 TTGAATATACTTAAAGGAGATGG - Intronic
1129575803 15:76744107-76744129 TTGTATGTAGTTAAAAGTAAGGG - Intronic
1136942567 16:34602481-34602503 TTGAATGGACTTGAATGGAATGG - Intergenic
1137004502 16:35261045-35261067 TTGTAAGCCCTTAAAAGGGACGG + Intergenic
1139317736 16:66087631-66087653 TGGGATGGAATTAAATGGGATGG + Intergenic
1139759279 16:69171504-69171526 TTGTACTTCCTTAAATGGTATGG + Intronic
1141199686 16:81887671-81887693 GTGTGTGTGCTTAGATGGGAAGG - Intronic
1141206574 16:81937749-81937771 CTGCATGTACTTATCTGGGAAGG - Exonic
1143398766 17:6626503-6626525 TTCTATGAACATAAATGGAACGG + Intronic
1145330130 17:21864635-21864657 TGGAATGTAATCAAATGGGATGG + Intergenic
1145333101 17:21889357-21889379 TGGAATGTACTTGAATGGAATGG + Intergenic
1145337344 17:21924144-21924166 TGGAATGTAATCAAATGGGATGG + Intergenic
1145338350 17:21932276-21932298 TGGAATGTACTCAAATGGAACGG + Intergenic
1145341407 17:21957957-21957979 TTGAATGTAATCAAATGGAATGG + Intergenic
1145695338 17:26782833-26782855 TGGAATGTACTTGAATGGAATGG + Intergenic
1145696818 17:26794977-26794999 TGGAATGTACTCAAATGGAATGG + Intergenic
1145705810 17:26870511-26870533 TGGTATGTAATCAAATGGAATGG + Intergenic
1148636496 17:49152898-49152920 GTGGATGTACTTACCTGGGATGG - Exonic
1149197633 17:54140812-54140834 TTGGATGTAGGTAAATGGGATGG - Intergenic
1203177481 17_KI270729v1_random:29782-29804 TTGAATGGACTTGAATGGAACGG + Intergenic
1203179268 17_KI270729v1_random:43726-43748 TGGAATGGACTTAAATGGAATGG + Intergenic
1203179385 17_KI270729v1_random:44655-44677 TTGAATGTACTGGAATGGAATGG + Intergenic
1203179802 17_KI270729v1_random:47764-47786 TTGAATGGACTCAAATGGAATGG + Intergenic
1203181167 17_KI270729v1_random:57976-57998 TTGTATGGACTGGAATGGAATGG + Intergenic
1203193518 17_KI270729v1_random:210882-210904 TGGAATGTACTCAAATGGAACGG + Intergenic
1203193607 17_KI270729v1_random:211686-211708 TGGAATGTACTTGAATGGAATGG + Intergenic
1203194445 17_KI270729v1_random:218716-218738 TAGAATGTACTCAAATGGAATGG + Intergenic
1203195785 17_KI270729v1_random:230171-230193 TTGTATGGAATTGAATGGAATGG + Intergenic
1203197420 17_KI270729v1_random:244969-244991 TGGAATGGACTTAAATGGAATGG + Intergenic
1203197856 17_KI270729v1_random:248700-248722 TTTTATGTAATCAAATGGAATGG + Intergenic
1203198091 17_KI270729v1_random:250614-250636 TGGAATGTAATTAAATGGAATGG + Intergenic
1203199718 17_KI270729v1_random:264572-264594 TTGAATGGACTTGAATGGAATGG + Intergenic
1203202882 17_KI270730v1_random:10312-10334 TGGAATGTACTCAAATGGAACGG + Intergenic
1203202971 17_KI270730v1_random:11116-11138 TGGAATGTACTTGAATGGAATGG + Intergenic
1203203803 17_KI270730v1_random:18122-18144 TAGAATGTACTCAAATGGAATGG + Intergenic
1203205256 17_KI270730v1_random:30529-30551 TTGTATGGAATTGAATGGAATGG + Intergenic
1203207025 17_KI270730v1_random:45740-45762 TGGAATGGACTTAAATGGAATGG + Intergenic
1203207460 17_KI270730v1_random:49454-49476 TTTTATGTAATCAAATGGAATGG + Intergenic
1203207695 17_KI270730v1_random:51368-51390 TGGAATGTAATTAAATGGAATGG + Intergenic
1203209313 17_KI270730v1_random:65281-65303 TTGAATGGACTTGAATGGAATGG + Intergenic
1203209970 17_KI270730v1_random:70654-70676 TGGAATGTACTCAAATGGAATGG + Intergenic
1154315770 18:13301995-13302017 TTATATGTACGTATCTGGGAGGG - Intronic
1154323383 18:13372006-13372028 TGGTTTCTACTTACATGGGACGG + Intronic
1155573902 18:27224471-27224493 TTGTTTGTTTTTAAATAGGAAGG + Intergenic
1159670446 18:71214755-71214777 ATGTTTGTAGTTAAGTGGGAGGG + Intergenic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1162618084 19:11817877-11817899 TTGTATGCACTAAAATGTAAAGG - Intronic
925613141 2:5720223-5720245 TTGGAGGTACTTAATTGGGAGGG - Intergenic
926644664 2:15276529-15276551 TTTTATGTATATAAATGGCAAGG - Intronic
928625655 2:33137373-33137395 TTGTTGGTACTTAAAGGTGAGGG + Intronic
930645894 2:53906544-53906566 TTGCATGTAATAAAATGGGAGGG + Intronic
930701955 2:54467273-54467295 TCTTATTTACTTGAATGGGAAGG + Intronic
931084415 2:58813552-58813574 TTGTATGCACTTAAGTAGGTCGG - Intergenic
934193321 2:89819237-89819259 TGGTGTGGACTCAAATGGGATGG - Intergenic
934193649 2:89821757-89821779 TGGAATGGACTCAAATGGGATGG - Intergenic
934193958 2:89824420-89824442 TGGAATGTACTTGAATGGAATGG - Intergenic
934195184 2:89832718-89832740 TTGTATGGAATTTAATGGAACGG - Intergenic
941738597 2:169008434-169008456 ATGTGTGTTCTTAAAAGGGATGG - Intronic
941848150 2:170151894-170151916 TTATATGTAAGTCAATGGGAAGG + Intergenic
943072598 2:183158748-183158770 TTTAAAGTACTTAAATGGAATGG + Intronic
943556959 2:189417605-189417627 TTTTATATTCTTGAATGGGAAGG - Intergenic
944452048 2:199853065-199853087 TTTTATGTAGTGAAATGGGCAGG - Intergenic
946824682 2:223665030-223665052 CTGCATGTACTTGAATGAGAGGG - Intergenic
946891912 2:224285399-224285421 TTGTGTCTACTTACCTGGGAAGG - Intergenic
947043223 2:225948591-225948613 TTGCATGTAATTAAATTGGTTGG - Intergenic
948031749 2:234823518-234823540 CTGTATTTACATAAATGTGAAGG + Intergenic
948224463 2:236298421-236298443 TCGTATGTACATAACTGAGAGGG - Intergenic
1169184286 20:3600726-3600748 TTATGTATACTTTAATGGGAGGG + Intronic
1169783969 20:9339115-9339137 TTTTATATACTTAAATTGTATGG + Intronic
1170312583 20:15008712-15008734 ATGCATGTACTTAAAGTGGATGG + Intronic
1170508511 20:17053945-17053967 TTCTATGTAATTACATGGTAGGG + Intergenic
1171918197 20:31076554-31076576 TGGAATGGACTTAAATGGAATGG + Intergenic
1171918296 20:31077339-31077361 TTGTATGGAATGAAATGGAAAGG + Intergenic
1171919428 20:31086501-31086523 TGGTATGGACTTCAATGGAATGG + Intergenic
1171921686 20:31104002-31104024 TTGAATGGACTCAAATGGAATGG + Intergenic
1171922455 20:31162066-31162088 TGGTATGGACTTCAATGGAACGG + Intergenic
1171922668 20:31163614-31163636 CTGAATGTACTCAAATGGAATGG + Intergenic
1171922672 20:31163647-31163669 TTGAATGTACTCATATGGAATGG + Intergenic
1171924074 20:31174592-31174614 TGATATGTACCTAAATGGAATGG + Intergenic
1171925290 20:31184197-31184219 TTGAATGGACTTGAATGGAAAGG + Intergenic
1171926045 20:31189405-31189427 TTGAATGGACTCAAATGGAATGG + Intergenic
1171926684 20:31194642-31194664 TGGAATGGACTTAAATGGAATGG + Intergenic
1171926783 20:31195422-31195444 TTGTATGGAATTAAATGGAAAGG + Intergenic
1171927929 20:31204660-31204682 TGGTATGGACTTCAATGGAATGG + Intergenic
1171930036 20:31220883-31220905 TGGGATGTACTCAAATGGAATGG + Intergenic
1171930189 20:31222157-31222179 TTGAATGGACTCAAATGGAATGG + Intergenic
1171930766 20:31227037-31227059 TGGAATGTACTTGAATGGAATGG + Intergenic
1171930964 20:31228794-31228816 TGGAATGGAATTAAATGGGAAGG + Intergenic
1171931727 20:31234931-31234953 TGGAATGTACTCAAATGGAATGG + Intergenic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1176528345 21:7938642-7938664 TGGTATGGACTTCAATGGAATGG - Intergenic
1176529540 21:7947423-7947445 TTGAATGTAATCAAATGGCATGG - Intergenic
1176748826 21:10674754-10674776 TGGAATGGACTCAAATGGGACGG - Intergenic
1176749276 21:10678040-10678062 TCGTATGGACTCAAATGGAATGG - Intergenic
1176749454 21:10679419-10679441 TTGAATGGACTCAAATGGAATGG - Intergenic
1176749729 21:10681441-10681463 TGGAATGTACTTGAATGGAATGG - Intergenic
1176749733 21:10681471-10681493 TGGAATGTACTTGAATGGAATGG - Intergenic
1176751157 21:10692326-10692348 TTGAATGGACTAAAATGGAATGG - Intergenic
1176751759 21:10696732-10696754 TGGAATGTACTTGAATGGAATGG - Intergenic
1176752148 21:10699580-10699602 TTGAATGGACTAAAATGGAATGG - Intergenic
1176752449 21:10701687-10701709 TGGAATGTACTCAAATGGAATGG - Intergenic
1176754042 21:10712485-10712507 TTGAATGGACTCAAATGGAATGG - Intergenic
1176754106 21:10712975-10712997 TTGAATGGACTCAAATGGAATGG - Intergenic
1176757538 21:10736716-10736738 TGGAATGTACTCAAATGGAATGG - Intergenic
1176856479 21:13979256-13979278 TTCTGTGTTCTTGAATGGGAAGG - Intergenic
1176868114 21:14064953-14064975 TTCTGTGTTCTTGAATGGGAAGG + Intergenic
1178079089 21:29044414-29044436 TTTTATATACTAAAATGGAAAGG - Intronic
1178204866 21:30453273-30453295 TAGAATGGACTGAAATGGGATGG - Intergenic
1178341555 21:31789566-31789588 TTATATTTACTAAAATGGAAGGG + Intergenic
1180282956 22:10719777-10719799 TGGAATGGACTTAAATGGAATGG - Intergenic
1180283125 22:10721021-10721043 TGGAATGTACTCAAATGGAATGG - Intergenic
1180283203 22:10721546-10721568 TGGAATGTACTCAAATGGAATGG - Intergenic
1180283703 22:10725115-10725137 TGGAATGGACTTAAATGGAATGG - Intergenic
1180283864 22:10726360-10726382 TGGAATGTACTCAAATGGAATGG - Intergenic
1180284132 22:10728381-10728403 TTGAATGGACTCAAATGGAATGG - Intergenic
1180284142 22:10728456-10728478 TTGAATGGACTCAAATGGAATGG - Intergenic
1182189539 22:28444105-28444127 ATGTATCTCCTTAAATAGGATGG - Intronic
949175228 3:1053648-1053670 TTGTTTGTTTTTTAATGGGATGG + Intergenic
949187919 3:1216220-1216242 TTGTATGTACACAGATGGAAAGG - Intronic
949745550 3:7288160-7288182 TTGTATATCCTTAAAGGAGAAGG - Intronic
951603252 3:24400278-24400300 TTGGATGTCCTTCAATGTGAGGG + Intronic
952051415 3:29388931-29388953 ATGTGTCTACATAAATGGGAGGG - Intronic
953294737 3:41703394-41703416 ATATATGTACTTAAATGTCATGG - Intronic
953725865 3:45398388-45398410 TTTTATGTACATATGTGGGATGG - Intronic
954591305 3:51785753-51785775 TTGTGTGTACTTAAAAAGAATGG + Intergenic
955436256 3:58902115-58902137 TTGTATGTATTGCAATGGAATGG - Intronic
956443742 3:69305783-69305805 TTGTATGAACTTGCATGGAATGG + Intronic
956551411 3:70463712-70463734 ATTTAAGAACTTAAATGGGAAGG - Intergenic
956637358 3:71379584-71379606 TTGTATGTTTTTAAATGGTTAGG + Intronic
957837888 3:85622884-85622906 TTTTCTGTACTCAAATGGGATGG + Intronic
959095554 3:101951508-101951530 TTGTCTGGAATTAAATGGCAAGG - Intergenic
959423932 3:106162108-106162130 TTATATGTACTTATATGAAAAGG + Intergenic
960010393 3:112828379-112828401 TTTTTTTTACTTACATGGGATGG - Intronic
960343404 3:116502754-116502776 TGGTATCTACTTGAATGGGGAGG + Intronic
960411029 3:117324948-117324970 TTGTATGTACTCTACTTGGAAGG - Intergenic
960766939 3:121142026-121142048 TTATATATCCTTAAATGGAAAGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965007764 3:163047056-163047078 GTGTTTGTAATTAAATGGCATGG - Intergenic
966166122 3:177018178-177018200 TTGAATGTACTTAAGTGGATGGG + Intergenic
966677131 3:182601764-182601786 TTGTATTTCCTTAAGTGGCAAGG + Intergenic
968862845 4:3186219-3186241 TTGTATACACATACATGGGATGG - Intronic
971038734 4:22726293-22726315 GTGTATGTATTTAAATGAGGAGG - Intergenic
971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG + Intronic
972018988 4:34284267-34284289 TTGTATTTACTTATATGTGTGGG - Intergenic
973841166 4:54862274-54862296 TTGTGTGTATTTAGATGGGAGGG - Intergenic
975110683 4:70619691-70619713 TGGTATGAACTTAAATGAAATGG - Intergenic
976789759 4:88864832-88864854 GTGTAAGTAGTTAAATGGAAAGG + Intronic
978527825 4:109683285-109683307 TGGTTTTTATTTAAATGGGAAGG + Intronic
978988926 4:115053310-115053332 CTCAATGTACTTAAATAGGATGG + Intronic
983455959 4:167965056-167965078 TTGAATATGCTTATATGGGAAGG - Intergenic
984656680 4:182326205-182326227 TTGTAGAAACGTAAATGGGATGG + Intronic
988560162 5:32273711-32273733 TTGTGTGTATTTATGTGGGATGG + Intronic
990240574 5:53812518-53812540 TTGAAGGTACTTAGATGGGTGGG - Intergenic
990770340 5:59236752-59236774 TTGTGTGTGGTTAAACGGGATGG + Intronic
994524602 5:100888003-100888025 ATCTATGGACTTATATGGGAAGG - Intronic
994840538 5:104920064-104920086 TTGTATAGTTTTAAATGGGAAGG - Intergenic
996082949 5:119275402-119275424 TTGTAGATACTGAACTGGGATGG + Intronic
997921480 5:137983483-137983505 GTGTATGTGCTAGAATGGGATGG + Intronic
998556200 5:143126262-143126284 TTGTTTGTATTAAAATGGCATGG + Intronic
1000844219 5:166258936-166258958 TTGGATGAAGTTAAATGGGCTGG - Intergenic
1000991435 5:167915806-167915828 TTGTATTTCCTTGATTGGGAGGG + Intronic
1004335392 6:14759844-14759866 TTTTATGTATTTAATTGAGAGGG + Intergenic
1008808993 6:55469521-55469543 TTATATGTAATAAAATGGAAAGG + Intronic
1009280872 6:61749311-61749333 TTGTACCTACTTAAATTGAAAGG - Intronic
1010071075 6:71746343-71746365 TTGCATGTAAAGAAATGGGAAGG + Intergenic
1011406641 6:87022486-87022508 TTGGATGAACTTAATTGGAACGG + Intergenic
1011892299 6:92180139-92180161 GTGTCAGTACTCAAATGGGAAGG - Intergenic
1012043291 6:94238250-94238272 TTATATATACTTATATGGCATGG + Intergenic
1012084831 6:94810981-94811003 TTGGATGTACTAAAAGGTGAAGG + Intergenic
1012284466 6:97372192-97372214 TTGTATGTAGGGAAATGGGGGGG - Intergenic
1016536394 6:145111428-145111450 TTATTTCTACTTAGATGGGAAGG - Intergenic
1018456020 6:163952935-163952957 TTTTATGTACTTAAAAAAGACGG + Intergenic
1019763676 7:2833148-2833170 TTGTTTGTACTTAAAAGAAATGG - Intronic
1026552535 7:71380622-71380644 GTTTTTTTACTTAAATGGGAGGG + Intronic
1026642305 7:72138642-72138664 TTTTATGTTGTTGAATGGGATGG - Intronic
1028400539 7:90420695-90420717 TTGTATCTTCTTAAAAGGGTTGG - Intronic
1028714090 7:93944179-93944201 TAGTTTGTACTTAAATTAGAAGG - Intergenic
1029621078 7:101690174-101690196 ATGCATGTACTTAAGTGGTAGGG + Intergenic
1030007044 7:105130036-105130058 TTATATGTACTTACACTGGAAGG + Intronic
1030417886 7:109268165-109268187 TTGTATGTACATGAATGGTTAGG - Intergenic
1034823310 7:154237036-154237058 TTGTTTGGACCTCAATGGGAAGG - Intronic
1035970398 8:4241382-4241404 TAGCAAGTACTTAAGTGGGAAGG - Intronic
1042041243 8:64592487-64592509 TAGTATGTTCTTGAAGGGGAAGG + Intronic
1042642216 8:70949094-70949116 TTTTTTTTACTTAAATGTGAAGG - Intergenic
1042807396 8:72786013-72786035 TTGTTTATAATTAAATGTGAAGG + Intronic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043550130 8:81362031-81362053 GTGTACGTACTTAACTGGTAAGG + Intergenic
1043615423 8:82119162-82119184 ATGTGTGTACATCAATGGGAAGG + Intergenic
1043662912 8:82768375-82768397 ATGTATGTATTTACATGTGAGGG - Intergenic
1045643933 8:104281892-104281914 TTGTATGGCCTGAAATGGGGAGG - Intergenic
1047425179 8:124738958-124738980 TTGTATGTTATGCAATGGGATGG - Intergenic
1047768226 8:128007465-128007487 TTATATGTACTAATATGGGATGG + Intergenic
1048255881 8:132904811-132904833 CTGTATTCACTGAAATGGGAAGG + Intronic
1051738281 9:20225907-20225929 TAGTATGTACATACATAGGAAGG + Intergenic
1054737915 9:68774440-68774462 ATGTATGTACTTCAATTGGAAGG - Intronic
1057832606 9:98418605-98418627 ATGTATATATGTAAATGGGAAGG + Intronic
1058014260 9:100012671-100012693 TTTTATGTACTAAAATGCAAAGG + Intronic
1059896696 9:118874068-118874090 TTGAATGTAATTAAAAGAGATGG - Intergenic
1203724954 Un_GL000216v2:42140-42162 TGGAATGTACTCAAATGGAATGG - Intergenic
1203727900 Un_GL000216v2:65344-65366 TTGAATGTACTCAAATGGAATGG - Intergenic
1203727990 Un_GL000216v2:66165-66187 TGGTATGTACTCAAATGCAATGG - Intergenic
1203728734 Un_GL000216v2:72101-72123 TTGAATGGACTCAAATGGAATGG - Intergenic
1203388614 Un_KI270438v1:77132-77154 TGGTATGGACTTCAATGGAATGG + Intergenic
1203344213 Un_KI270442v1:20094-20116 TGGGATGTACTCAAATGGAATGG + Intergenic
1203344914 Un_KI270442v1:27103-27125 GTGGATGTAATGAAATGGGAAGG + Intergenic
1203348722 Un_KI270442v1:58485-58507 TTGAATGGACTCAAATGGAATGG + Intergenic
1203350316 Un_KI270442v1:76218-76240 TGGAATGGACTTTAATGGGATGG + Intergenic
1203675437 Un_KI270756v1:18183-18205 TTGTATGAACTGGAGTGGGATGG - Intergenic
1203679547 Un_KI270756v1:52004-52026 TGGAATGTACTTGAATGGAATGG - Intergenic
1203680611 Un_KI270756v1:61012-61034 TGTTATGTACTCAAATGGAATGG - Intergenic
1203681792 Un_KI270756v1:70534-70556 TTGAATGTAATTAAATGAAATGG - Intergenic
1188314016 X:28651656-28651678 GTGTATGTTCTCAAATGAGAAGG - Intronic
1188996773 X:36896558-36896580 TTACCTGTATTTAAATGGGATGG + Intergenic
1190269846 X:48854025-48854047 TTGTAAGCCCTTAAAAGGGATGG + Intergenic
1191123846 X:56933294-56933316 TTCTGTCTACTGAAATGGGAGGG + Intergenic
1200880997 Y:8211098-8211120 TTGTCTTCACTTGAATGGGAAGG + Intergenic
1201114100 Y:10822430-10822452 TTGAATGTAGTGAAATGGAACGG - Intergenic
1201197442 Y:11508153-11508175 TTGAATGGACTTGAATGGAATGG + Intergenic
1201198635 Y:11518940-11518962 TTGAATGTACTCGAATGGAACGG + Intergenic
1201202902 Y:11556740-11556762 TGGAATGTACTCAAATGGAATGG + Intergenic
1201208878 Y:11659255-11659277 TGGAATGTATTTAAATGGGATGG + Intergenic
1201213252 Y:11699951-11699973 TGGAATGTACTCAAATGGAAAGG + Intergenic
1201218705 Y:11746127-11746149 TCTAATGTACTTAAATGGAATGG + Intergenic