ID: 971248884

View in Genome Browser
Species Human (GRCh38)
Location 4:24955147-24955169
Sequence CCTTGGTTCTGGAGACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971248884 Original CRISPR CCTTGGTTCTGGAGACTGGG AGG Intronic
900168448 1:1254461-1254483 CCTCGGTGCTGCAGGCTGGGGGG - Intronic
900250461 1:1666095-1666117 GCCTGGGTCTGGAGGCTGGGTGG + Intronic
901000087 1:6144684-6144706 GCTTGATTCTGGCCACTGGGAGG + Intronic
902337835 1:15764074-15764096 CCCAGGTTTTGGAGATTGGGTGG + Intronic
903114003 1:21162956-21162978 CCTTTGTTCTAGAGGCTGAGGGG - Intronic
903191531 1:21659302-21659324 CCCTGGTCCTGGAGCCCGGGCGG - Intronic
903253640 1:22075805-22075827 CCTGGGTTCTGGAGTCAGAGTGG - Intronic
906690728 1:47791228-47791250 CTGTGGTTCTGGAGTCTGGATGG - Intronic
907290813 1:53411790-53411812 CCCTGGTTCTTGAGAGTGTGTGG - Intergenic
909806802 1:79882489-79882511 ACATGGTCCTGGAGAGTGGGAGG + Intergenic
910101694 1:83584053-83584075 CCACGGTTCTGTAGACTGAGAGG + Intergenic
911199545 1:95031012-95031034 CTTCTGGTCTGGAGACTGGGAGG - Intronic
911768659 1:101711131-101711153 CCACAGTTCTGGAGACTAGGGGG - Intergenic
911941641 1:104055032-104055054 CCTGGCTCCTGGAGACTGTGAGG + Intergenic
912525984 1:110282987-110283009 TCATGGTTCTGCAGGCTGGGAGG + Intronic
917314277 1:173708506-173708528 CCATAGTTCTGGAGGCTGGGAGG - Intergenic
917692833 1:177486736-177486758 CCTTCCTTGTGGAAACTGGGAGG - Intergenic
918576489 1:186067169-186067191 ACTTGATTATGGAAACTGGGGGG - Intronic
919306957 1:195854301-195854323 CCTTGGTTCTTGTGACTGTAGGG - Intergenic
919424891 1:197417700-197417722 CCATGGTTTCTGAGACTGGGAGG - Intronic
920117309 1:203629782-203629804 CCTTGAATCTAGAGACTTGGTGG - Intronic
920217153 1:204368976-204368998 CCTGGGTTCTGCAGAGTGGCAGG + Intronic
1062977553 10:1696687-1696709 CCCAGGGTCTGGAGCCTGGGTGG + Intronic
1065114367 10:22470368-22470390 TCATGGTTCTGGGGTCTGGGAGG + Intergenic
1073143270 10:101262768-101262790 CAGTGTTTCTGGGGACTGGGGGG - Intergenic
1074276980 10:112012598-112012620 CCTTTCGTCTGAAGACTGGGGGG - Intergenic
1075945408 10:126428695-126428717 CTTTGGGTTTGGGGACTGGGAGG + Intronic
1076667615 10:132102132-132102154 CCTTGCTGCTGGAGAATGAGAGG - Intergenic
1076739910 10:132478019-132478041 TCTGGGTTCTGGAGGCTGAGGGG - Intergenic
1077170401 11:1163535-1163557 GCTGGGTTCTGTGGACTGGGAGG + Intronic
1077213204 11:1382970-1382992 CCTTGGTGAGGGAGACGGGGCGG + Intergenic
1077402327 11:2365352-2365374 CCCTGGTCCTAGAGGCTGGGAGG + Intergenic
1078897753 11:15612646-15612668 CCTGGGTTTGGGAGACTTGGGGG - Intergenic
1079615506 11:22487743-22487765 CCATGGTTCTGAAGGCTGGAAGG - Intergenic
1080897080 11:36455836-36455858 GCTTGGCTCTGGAGTCTGGCGGG + Intronic
1081003025 11:37697816-37697838 CAGTGGTTCTGGAAATTGGGTGG - Intergenic
1082782230 11:57296655-57296677 CCATAGTTCTGGAGGCTTGGAGG - Intergenic
1084502599 11:69543743-69543765 TCATAGTTCTGGAGGCTGGGAGG - Intergenic
1085721551 11:78916500-78916522 CTTTAGGTCTGGACACTGGGAGG + Intronic
1085913107 11:80851788-80851810 TGTTGGTGCTGGACACTGGGAGG - Intergenic
1087512691 11:99117869-99117891 CCACAGTTCTGGAGACTGGGAGG - Intronic
1087608276 11:100404114-100404136 CCTTGACTCTGTAGACTGGGAGG - Intergenic
1088499074 11:110464320-110464342 TCATGGTTCTGGAGGCTGGGAGG + Exonic
1089238760 11:117055936-117055958 TCATAGTTCTGGAGGCTGGGAGG - Intronic
1089393997 11:118123038-118123060 TCACAGTTCTGGAGACTGGGAGG - Intergenic
1089452202 11:118606636-118606658 TCTTGGTCCAGGAGACTGGCTGG - Exonic
1089575137 11:119436795-119436817 GCTGGGTTTTGGAGACTGAGTGG + Intergenic
1091788772 12:3259024-3259046 CCTTCTTTCTGGATACTGGCTGG - Intronic
1093515594 12:19982855-19982877 TCACAGTTCTGGAGACTGGGAGG - Intergenic
1094312527 12:29099910-29099932 TCATGATTCTGGAGACTGGGAGG - Intergenic
1095310823 12:40694179-40694201 CCTTAGTCCTGGAAAGTGGGTGG - Intronic
1095891183 12:47236027-47236049 CCCTGGTGATGGAGAATGGGAGG - Exonic
1096750082 12:53752975-53752997 CCTTGGTGCAGGAGTCTTGGGGG - Intergenic
1097003799 12:55900664-55900686 CGTTGGTCCTGGAGAAAGGGAGG - Intergenic
1102900403 12:116632266-116632288 CATGGGTTCTCGAGACTGAGAGG - Intergenic
1103823081 12:123713570-123713592 TTTTGGTGCTGGAGACTCGGTGG + Intronic
1103865093 12:124045277-124045299 TCTTTGCTCTGGAGCCTGGGTGG + Intronic
1104735835 12:131135643-131135665 CCTGGGTTCTGGACGCTGCGGGG + Intronic
1105432256 13:20347353-20347375 CCACAGTTCTGGAGGCTGGGAGG - Intergenic
1105576789 13:21661269-21661291 TCATGATTCTGGAGGCTGGGAGG + Intergenic
1107394171 13:39998107-39998129 CCTTGGTGCTGGAGAACGAGTGG + Intergenic
1108824762 13:54399215-54399237 CTGTGATTTTGGAGACTGGGAGG - Intergenic
1112456347 13:99566890-99566912 CCATGGATCTGAAGACTTGGAGG - Intergenic
1114549551 14:23525138-23525160 ACTTGGTTCTGGAGAACCGGCGG + Exonic
1115845734 14:37531339-37531361 ACTTGGTCCTGTAGAATGGGTGG - Intronic
1116870428 14:50064474-50064496 CCACAGTTCTGGAGGCTGGGAGG - Intergenic
1118366405 14:65101387-65101409 GCCTGGTTCTGGAGGGTGGGGGG - Intronic
1120237186 14:81905315-81905337 TCATGGTCCTGGAGACTGGGAGG + Intergenic
1120318367 14:82927087-82927109 CCTGGGTTATGGAGCCTGGCAGG - Intergenic
1120507744 14:85374576-85374598 CCACAGTTCTGGAGGCTGGGAGG - Intergenic
1121178573 14:91909728-91909750 TCATGGTTCTGGAGGCTGAGAGG - Intronic
1121778762 14:96608335-96608357 TCATGGTTCTGGAGGCTGGCTGG + Intergenic
1122241299 14:100369570-100369592 CCTGTGTTCTGGGCACTGGGTGG - Intronic
1122465823 14:101932833-101932855 CCTTGGTTCTGTGGGCTGTGGGG - Intergenic
1123008152 14:105334211-105334233 CCTTGGCCCTGGAGTCTGGCAGG - Intronic
1125990227 15:44099529-44099551 CATGGGTTCTGGAGAATGGAAGG + Intronic
1127176711 15:56365734-56365756 ACTTTTTTCTGGAGACTGGCTGG + Intronic
1129174841 15:73832559-73832581 CCCTGCTTCAGGAGACTGAGGGG - Intergenic
1129228316 15:74182518-74182540 CCTTGGTTCTGGGGGCAGCGGGG - Intronic
1129701865 15:77772901-77772923 CTTCGGCTCTGGGGACTGGGAGG + Intronic
1130553113 15:84904570-84904592 CCTTGGCTCTGCAGACAGGCTGG - Intronic
1130705755 15:86231742-86231764 CCAGGGGTCTGGAGACTGGCAGG - Intronic
1130925451 15:88382482-88382504 CCTTGCTGCTGGAGCCTGTGAGG - Intergenic
1131009311 15:89004170-89004192 GATTGGTTCTGGAGGTTGGGGGG - Intergenic
1132645241 16:996465-996487 CCTGGGTTCTGGAGAGCAGGTGG - Intergenic
1132950933 16:2562200-2562222 CCTTGGCTCAGGAATCTGGGAGG + Intronic
1132963416 16:2637970-2637992 CCTTGGCTCAGGAATCTGGGAGG - Intergenic
1133398192 16:5464974-5464996 ACAGGGGTCTGGAGACTGGGAGG + Intergenic
1133492374 16:6282783-6282805 CCTTGGTTCTGAAGACTTACAGG - Intronic
1134248978 16:12561246-12561268 CCTTGGATCTGTGGAGTGGGAGG - Intronic
1135067570 16:19323447-19323469 CATTGATGCTGGAGACTTGGAGG - Intergenic
1135968361 16:27053957-27053979 CCTTGGTGGTGGAACCTGGGAGG - Intergenic
1138085599 16:54131226-54131248 TCTTGGTTCTAGAAAATGGGAGG + Intergenic
1138588259 16:57985371-57985393 CCGTGGTCCTGAAGACTGGGAGG - Intronic
1139478163 16:67213532-67213554 CCTTCATTCTGGAGCCTGGCTGG + Intronic
1140503872 16:75457542-75457564 CCTCAGTTCTGGAGGCTGGAAGG - Intronic
1140512710 16:75519651-75519673 TCATGGTTCTGGAGGCTGGGAGG + Intergenic
1140851500 16:78938887-78938909 CGTGGGTACTGGAGAGTGGGAGG + Intronic
1141160745 16:81627872-81627894 CCTTGGTGCTGGGGACTTTGAGG - Intronic
1141863751 16:86735768-86735790 TTATAGTTCTGGAGACTGGGAGG + Intergenic
1142668793 17:1477846-1477868 GCCTGGTGCTGGAGGCTGGGTGG - Intronic
1143504590 17:7356645-7356667 CCTTAGAGCTGGAGGCTGGGAGG - Exonic
1144213308 17:13033316-13033338 GCTGGCTTCTGGAGAATGGGAGG + Intergenic
1144484100 17:15650902-15650924 ACTTGGTTTTGGAAACTGTGTGG - Intronic
1144639352 17:16929017-16929039 CCTTGTTTCTGAAGCCAGGGAGG + Intergenic
1145779292 17:27551776-27551798 CCGTGGTGCTGGAGGCAGGGAGG - Intronic
1146641567 17:34545815-34545837 CCTTGGGTTTGAAGACTTGGAGG + Intergenic
1147296863 17:39490670-39490692 CTTTGGTTCTGGAGAGTCTGGGG - Exonic
1147874492 17:43611460-43611482 CCTTGGAGCAGGAGAGTGGGTGG - Intergenic
1148126052 17:45237531-45237553 CCTTGGTTCTGGAGAGAGAAGGG - Exonic
1149615012 17:57989637-57989659 CCTTCATTCTGGTGACTGAGGGG - Exonic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1151308484 17:73279168-73279190 CCTGGGTGCTGCAGCCTGGGAGG - Intergenic
1152145502 17:78566124-78566146 TCTCAGTTCTGGAGGCTGGGAGG - Intronic
1152878379 17:82801172-82801194 CCTTGGTTCTGGACACAGTTGGG + Intronic
1155160564 18:23192277-23192299 CCCTGGTTTTCCAGACTGGGTGG + Intronic
1156785231 18:40904533-40904555 CATAGGTTCTGGAGACTTTGTGG - Intergenic
1157273630 18:46294834-46294856 CCTTGGTGGTGGGGACTGAGGGG + Intergenic
1158936697 18:62371165-62371187 CCTTGGTTGTGGAGACAGACAGG + Intronic
1159012532 18:63071564-63071586 TCATGGTTCTGGAGGCTGGCAGG + Intergenic
1159100595 18:63953784-63953806 CCTTGGTTCTGGCTAGTGGATGG + Intronic
1160176927 18:76602344-76602366 CCTGGAATCTCGAGACTGGGAGG + Intergenic
1160280748 18:77487903-77487925 CTTTGGTTGGGGAGACAGGGAGG + Intergenic
1160687896 19:445415-445437 TCACGGTTCTGGAGGCTGGGAGG - Intronic
1160739087 19:677617-677639 CCAGGGTTCTGGAGCCAGGGTGG + Intronic
1161990472 19:7681496-7681518 CCTGGGTTCTGAAGGCTGGGAGG - Intronic
1162774354 19:12969974-12969996 CCTTCGTTCAGGTGAGTGGGTGG + Exonic
1163440064 19:17318126-17318148 CCTGGGAGGTGGAGACTGGGAGG - Intronic
1163471162 19:17497683-17497705 CCTTGGGTCAGGAGAGTTGGAGG + Intronic
1164623647 19:29712875-29712897 CCAGGGTTCTGCAGAATGGGAGG + Intronic
1165408084 19:35642781-35642803 CCTAGGTTCCTGGGACTGGGTGG + Intronic
1166364502 19:42271843-42271865 CCTTGGCCCTGGTGGCTGGGGGG - Intronic
1167732866 19:51271551-51271573 CCTTGGACCCTGAGACTGGGAGG + Intergenic
1168712477 19:58509804-58509826 CCGTGGTCCTGTAGACTGGAGGG + Intronic
925388945 2:3482657-3482679 CCCTGGCTGTGGAGAGTGGGTGG + Intronic
927475986 2:23414501-23414523 GCTGGGTCCTGCAGACTGGGTGG + Intronic
930000994 2:46861325-46861347 CCTTGGTTTTGCAGACTAGGAGG + Intergenic
930095078 2:47560794-47560816 CCTTTGTTCTGGGGAGTGAGGGG - Intronic
931551220 2:63449373-63449395 CCTTCTTTCTGGAAAGTGGGGGG - Intronic
934796210 2:97102131-97102153 TCATAGTTCTGGAGGCTGGGAGG + Intergenic
936063904 2:109316275-109316297 CCTCGGTCCAGGAGGCTGGGTGG + Intronic
936250145 2:110862155-110862177 GCTTGGCTGTGGGGACTGGGAGG - Intronic
936396735 2:112137435-112137457 TCACAGTTCTGGAGACTGGGAGG - Intergenic
938391958 2:130913978-130914000 ACCTGGCTCTGGAGTCTGGGAGG - Intronic
938768362 2:134479119-134479141 TCATGGTTCTGGAGGTTGGGAGG - Intronic
939162147 2:138603524-138603546 CCACGGTTCTGGAGGCTGGGAGG + Intergenic
942284470 2:174401139-174401161 CCTGGATTCTGGAGACTGCAGGG + Exonic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945261723 2:207849945-207849967 TCCTGATTCTGGAGGCTGGGAGG + Intronic
946368363 2:219265082-219265104 CCATGGAACTGAAGACTGGGAGG + Intronic
948803906 2:240444884-240444906 CCTTGGCTCTGGAGACTGCAGGG + Intronic
948986296 2:241526545-241526567 TCATGGTTCTGGAGGCTGAGAGG + Intergenic
1169496247 20:6118371-6118393 CTTTGGTAGTGGTGACTGGGAGG + Intronic
1169572141 20:6917995-6918017 CCTTGATTTTGGAGAAGGGGAGG + Intergenic
1169749415 20:8976424-8976446 TCATGGTTCTGGAAACTGAGTGG - Intergenic
1170491989 20:16886549-16886571 CCTTTGTCCTGGAGTCGGGGAGG + Intergenic
1172006516 20:31822195-31822217 AGTGGGTTCTGGAGTCTGGGTGG - Intronic
1173773645 20:45685030-45685052 CCTTGGTTCTGGGGCCATGGAGG - Intronic
1174380389 20:50152438-50152460 TCCTGGTTCAGGTGACTGGGAGG - Intronic
1176920591 21:14683477-14683499 TCATGGTTCTGGAGACTGGGAGG - Intergenic
1177203610 21:17985847-17985869 TCATGGTTCTGGAGGCTGGGAGG + Intronic
1179508931 21:41859507-41859529 CTTTGGGTCTGCAGACGGGGAGG - Intronic
1180143862 21:45909078-45909100 CCTTGGTCGTGGAGACCTGGTGG - Intronic
1181266762 22:21635164-21635186 TCTTGGGGCTGGAGACTGTGGGG - Exonic
1181581885 22:23833163-23833185 CCCTGGCTCTGGACACTGAGTGG + Intronic
1183355721 22:37358257-37358279 CCTACTTCCTGGAGACTGGGGGG - Intergenic
1184487049 22:44786059-44786081 CCATGGTGCTGGACACTGGATGG + Intronic
950365434 3:12480264-12480286 CCTTGGTTCCGGAGCCAGGGAGG - Intergenic
950973607 3:17215987-17216009 CCTAGGTTCTGCACTCTGGGAGG - Intronic
951908498 3:27726211-27726233 CCTTGGTTGTGGGGGGTGGGTGG - Intergenic
952885806 3:38010323-38010345 CCTTGGGTCGGGAGTCTGGGTGG - Intronic
953960912 3:47265011-47265033 ACATAGTTCTGGAGACTGGAAGG - Intronic
954152611 3:48665005-48665027 CCTAGGTCTTGGAGACTGTGTGG + Intergenic
954354462 3:50073283-50073305 TCATGCTTCTGGAGGCTGGGAGG + Intronic
954661557 3:52229421-52229443 CCCTGGGCCTGGAGACAGGGAGG - Intronic
955412464 3:58664766-58664788 CCTTGCTTCTGGAGGCTCAGAGG - Intronic
956236512 3:67078182-67078204 TCATGGTTCTGGAGGCTGGGAGG - Intergenic
956407507 3:68943483-68943505 CCTTGTTTATCAAGACTGGGTGG - Intergenic
960053631 3:113260907-113260929 CCATGGGTGGGGAGACTGGGGGG - Intronic
962200867 3:133400197-133400219 CATTGGTCCTGGAGGCTGGGGGG - Exonic
962916503 3:139909147-139909169 CCATGGCTTTGGAGACAGGGTGG - Intergenic
964671058 3:159226741-159226763 GATTAGTTCTGGAGACAGGGAGG + Intronic
964814160 3:160698757-160698779 CCTTTGTTTTGCAGAGTGGGTGG + Intergenic
964835032 3:160928843-160928865 TCATAGTTCTGGAAACTGGGAGG - Intronic
968573367 4:1353894-1353916 CCTTGGCACTGCAGCCTGGGTGG + Intronic
968598229 4:1496213-1496235 CCTGGGTGCTGGAGGCTGGCTGG + Intergenic
969093316 4:4713133-4713155 TCATAGTTCTGGAGGCTGGGAGG + Intergenic
969212167 4:5696351-5696373 ACTTGGCTCTGTAGACTGAGCGG - Intronic
969303371 4:6310408-6310430 CCTAGATTCTGCAGGCTGGGTGG + Intergenic
969593212 4:8133515-8133537 ACTGTGTGCTGGAGACTGGGAGG - Intronic
970509641 4:16768675-16768697 CCTTGGTTTTGGAGAAAGGGTGG - Intronic
971248884 4:24955147-24955169 CCTTGGTTCTGGAGACTGGGAGG + Intronic
972926571 4:44015942-44015964 CTTTGGGTCTGGAGACAGGCTGG - Intergenic
973976470 4:56267922-56267944 CCTTAGTTCTGAGAACTGGGAGG - Intronic
974413126 4:61567574-61567596 TCATCGTTCTGGAGGCTGGGAGG - Intronic
974995860 4:69157789-69157811 CATTGGATTTGGAGACTTGGGGG + Intronic
975008926 4:69324190-69324212 CATTGGATTTGGAGACTTGGGGG + Intronic
977233906 4:94484033-94484055 CCTTGTTTCTGGAGACATGCAGG - Intronic
979638042 4:122978945-122978967 CCTGGGTTCTCGAGAGTGGAGGG + Intronic
981056861 4:140372175-140372197 GATTGGTTCTGGAGATTGGTTGG + Intronic
982082421 4:151803787-151803809 CTACAGTTCTGGAGACTGGGAGG + Intergenic
982693697 4:158575702-158575724 TCATAGTTCTGGAGACTGGGAGG - Intronic
985752514 5:1688962-1688984 CATTGGGTCTGGAGAGTGGTCGG + Intergenic
986152381 5:5139915-5139937 CCTTGGGGCTGGGGACTCGGCGG - Intergenic
986579577 5:9251218-9251240 TCATGGTTCTGGAGGCTGTGAGG - Intronic
987046390 5:14113157-14113179 CCATGGTTCTGGAGGTTGGCTGG + Intergenic
989411248 5:41122175-41122197 CTTTGGTTGTGAAGAGTGGGAGG - Intergenic
989421214 5:41241195-41241217 CCTTGCTGCTGGAGGCGGGGTGG + Intronic
990155638 5:52874091-52874113 TCATGATTCTGGAGGCTGGGAGG + Intronic
991431781 5:66555544-66555566 TCATAGTTCTGGAGGCTGGGAGG - Intergenic
992124457 5:73626288-73626310 CCTGGGTTCTGGAGGCTGCGGGG + Exonic
993831561 5:92766296-92766318 TCATGGTTCTGGAAGCTGGGAGG + Intergenic
994147239 5:96409228-96409250 CTTCGGTGCTGGAGCCTGGGTGG - Intronic
998177146 5:139908861-139908883 CCTTTGCTCTGGAAACTGGGAGG - Intronic
998310490 5:141124316-141124338 TCTTGGTTCAGGACACCGGGAGG + Exonic
1000491857 5:161923936-161923958 CATTGGCTTTGGAGACAGGGAGG + Intergenic
1001634699 5:173201495-173201517 CCTTGGGTCTAGTGACTGGAAGG + Intergenic
1002053374 5:176584518-176584540 GCTTGGTGCTGGGGGCTGGGTGG + Exonic
1003059965 6:2855185-2855207 CCTTTGTTCGGGAGGCAGGGGGG + Intergenic
1003270903 6:4607010-4607032 CTTTGGTGCTGCCGACTGGGAGG - Intergenic
1003573154 6:7269077-7269099 CCTTGCACCTGGAGACTGCGAGG + Intronic
1004381464 6:15136288-15136310 CCTTGGATCTGAAGACTTGTGGG + Intergenic
1004881449 6:20012478-20012500 TCATGGTTCTGGAGGCTGGAGGG - Intergenic
1006912903 6:37575717-37575739 CCTTGCTTCTGGGGAGTGGCTGG + Intergenic
1008706437 6:54166018-54166040 CCACAGTTCTGGAGGCTGGGAGG - Intronic
1009623134 6:66101240-66101262 TCATAGTTCTGGATACTGGGAGG + Intergenic
1010121032 6:72376419-72376441 CCTTAGTTCAGAAGACTTGGGGG - Intronic
1011517921 6:88172508-88172530 TCACGGTTCTGGAGGCTGGGAGG - Intergenic
1016574586 6:145554585-145554607 TCATGGTTCTGGAGGCTAGGAGG + Intronic
1018148893 6:160920402-160920424 TCTGGGTTCTGGACTCTGGGGGG - Intergenic
1019506065 7:1392110-1392132 CCTGGGCTCTGCAGACAGGGCGG - Intergenic
1019929515 7:4214555-4214577 CCTTGGCTCTGCAGGCTGAGGGG + Intronic
1020475850 7:8593503-8593525 CCATGGTTCAGGAGACTAGGGGG - Intronic
1021468234 7:20969991-20970013 CCATGGTTCTGAAGGCTGAGAGG - Intergenic
1021952235 7:25786192-25786214 TCATGGTTCTAGAGGCTGGGAGG - Intergenic
1022921715 7:35022914-35022936 CCTTGGTGCTGGCGGCTGGGCGG + Intronic
1023656660 7:42429249-42429271 ATTTGGTACTGGAGGCTGGGTGG + Intergenic
1024182915 7:46915714-46915736 CCTTGTTTCTTGAGACTATGAGG + Intergenic
1024853600 7:53750188-53750210 CCTTGACTGTGGAGCCTGGGAGG + Intergenic
1024922786 7:54577431-54577453 CTATGGTTCTGCAGGCTGGGAGG - Intergenic
1030278487 7:107744500-107744522 CCTACGTTATGGAGACTGGCGGG + Intronic
1032592120 7:133201094-133201116 GGTTGCTTCTGGAGACTGTGAGG + Intergenic
1035486283 7:159228728-159228750 CCTTTGGCCTGGAGACTGGGAGG + Intergenic
1035876139 8:3191513-3191535 CCTAGGTTCTGTAAAATGGGAGG + Intronic
1036504343 8:9341864-9341886 CCTGGCTTCTGGTGACTTGGTGG - Intergenic
1036645986 8:10611662-10611684 CCTTGGTTCTGCAGGTTGGACGG - Exonic
1037206452 8:16326410-16326432 TCATGCTTCTGGGGACTGGGAGG + Intronic
1037944756 8:22981876-22981898 CCTTGCTGCTGCAGCCTGGGCGG + Intronic
1038368305 8:26960795-26960817 TCATGGTTCTGGAGGCTGGAAGG - Intergenic
1038888128 8:31688432-31688454 TCATGGCTCTGGAGACTGAGAGG - Intronic
1040552266 8:48446627-48446649 CCTTGTTGCTGGAGCCGGGGAGG + Intergenic
1041597107 8:59667711-59667733 TCATGGTTCTGGAGGCTGGAAGG + Intergenic
1042420338 8:68581333-68581355 CCTTTCTTCTGGGTACTGGGAGG + Intronic
1044620729 8:94188440-94188462 CCCTGGTTCAGGGGACGGGGAGG + Intronic
1045609757 8:103825134-103825156 AGTTGGTTCTGGAGGCTGAGGGG - Intronic
1046097768 8:109580740-109580762 CCTTTGTTCTGGAGGCAGTGGGG - Intronic
1046595999 8:116261954-116261976 CTTTGCTTCTGGAAACTGAGCGG + Intergenic
1046913248 8:119652080-119652102 TCATAGTTCTGGAGGCTGGGAGG + Intronic
1049573648 8:143380835-143380857 CCTTCGTCCTGGAGAAAGGGAGG + Intronic
1049768339 8:144366369-144366391 TATTGGTTCTGGAGATTTGGAGG + Intergenic
1049985592 9:947969-947991 CCTTGCTGCTGCTGACTGGGAGG + Intronic
1051078951 9:13274353-13274375 CCTTGGATCTGGAGGCAGAGTGG + Intronic
1052821343 9:33139889-33139911 TCTTGGCTCTGGAAGCTGGGAGG + Intronic
1056602131 9:88054580-88054602 CCTGGGTCCTGGGCACTGGGTGG + Intergenic
1056776987 9:89520333-89520355 CTACCGTTCTGGAGACTGGGAGG + Intergenic
1057522167 9:95768740-95768762 CCAAAGTTCTGGAGTCTGGGAGG - Intergenic
1058651779 9:107181759-107181781 CCTGGGTTCTGGGGAGTCGGGGG - Intergenic
1061907466 9:133705988-133706010 CCACATTTCTGGAGACTGGGAGG - Intronic
1186479844 X:9888213-9888235 CCTTGGTTCTGGCTGCTGGCTGG + Intronic
1186743812 X:12545449-12545471 CTTTGGTCCTGATGACTGGGAGG - Intronic
1189286401 X:39854999-39855021 TCATGGTTCTGGAGGCTGAGAGG - Intergenic
1192040899 X:67620406-67620428 CCTTGGTACTAGAGTCTAGGCGG - Intronic
1195754789 X:108190099-108190121 CCTTGGTTTTGCAAACTGGGAGG + Intronic
1196035363 X:111138099-111138121 CTTTGGTTCTGGAGACAAAGTGG + Intronic
1196813140 X:119644429-119644451 TCATAGTTCTGGAGGCTGGGAGG + Intronic
1197775546 X:130116594-130116616 CCCAGGTTCTGGAGACAAGGTGG + Intergenic
1197873700 X:131083295-131083317 CCTGGCTATTGGAGACTGGGTGG + Intronic
1197929555 X:131680271-131680293 CCTTGATTCTGCGGTCTGGGAGG + Intergenic
1197945908 X:131840126-131840148 CCTTGATTCTGTGGTCTGGGAGG - Intergenic
1198178911 X:134184996-134185018 CCTTGGTTCTAGAGCATGGCAGG - Intergenic
1199434120 X:147794100-147794122 GGTTGGTTTTGGAGTCTGGGAGG - Intergenic
1199996186 X:153028220-153028242 CCTTGCTGCAGGAGTCTGGGTGG + Intergenic
1200059370 X:153477374-153477396 CCTGGGGTCGGGAGACTGGACGG - Intronic