ID: 971250220

View in Genome Browser
Species Human (GRCh38)
Location 4:24968204-24968226
Sequence GGGTGCTTGAAAATGCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971250213_971250220 15 Left 971250213 4:24968166-24968188 CCACAGATGATTTTGGTTGAGGC 0: 1
1: 0
2: 5
3: 14
4: 127
Right 971250220 4:24968204-24968226 GGGTGCTTGAAAATGCTAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 100
971250218_971250220 -7 Left 971250218 4:24968188-24968210 CCTGTGGCAGTGCACGGGGTGCT 0: 1
1: 0
2: 1
3: 10
4: 120
Right 971250220 4:24968204-24968226 GGGTGCTTGAAAATGCTAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971250220 Original CRISPR GGGTGCTTGAAAATGCTAGG AGG Intronic
901453948 1:9352770-9352792 AGGTAATTGAAAATGCCAGGAGG - Intronic
902187629 1:14737222-14737244 GGGTGCTCCAACATGCAAGGAGG + Intronic
903836386 1:26205972-26205994 GGATGCTTGGAAAGGGTAGGGGG - Intergenic
908179189 1:61587351-61587373 GGGTGCATGACAGGGCTAGGAGG - Intergenic
908389297 1:63670458-63670480 GGGTGCTTGTGCATCCTAGGCGG + Intergenic
908571695 1:65418151-65418173 GGGTGGTTGGAAATGGAAGGGGG + Intergenic
910360863 1:86412667-86412689 GAGTGCTTGAGAATGCTATCAGG - Intergenic
910557714 1:88554541-88554563 GAATGCTTGATAATGCTATGAGG + Intergenic
915699285 1:157775565-157775587 GGGGTCTTGAGAAGGCTAGGTGG + Intronic
1065833233 10:29633497-29633519 GGGCGTTTGAAAATGCATGGGGG - Intronic
1075106740 10:119544054-119544076 GAGTGCTTGGAAATGCTCGGAGG - Intergenic
1077290319 11:1786711-1786733 AGGTGCTTAAAAATGGAAGGAGG - Intergenic
1079593819 11:22215820-22215842 GGTTGCTAGAATATGGTAGGAGG - Intronic
1083064958 11:59914895-59914917 GGGTGCTTAAAAAAACTGGGGGG + Intergenic
1083132892 11:60642883-60642905 GTGTGCTTAAAATTGCTAAGGGG - Intergenic
1093225635 12:16479905-16479927 AGGTGTTTTAAAATGTTAGGTGG - Intronic
1104308003 12:127627227-127627249 GGCTGCTGGAAAGTGCTAGAGGG + Intergenic
1104860685 12:131921811-131921833 GGGTGATTGACAAAGCTGGGTGG - Exonic
1105441528 13:20419243-20419265 GGGTCCTTGCAAATGCTACAGGG + Intronic
1107952355 13:45475145-45475167 GGGTGGGTGGAAATGGTAGGAGG + Intronic
1108152589 13:47551593-47551615 AGGTGCTTGAAAATGATTGCTGG - Intergenic
1118143871 14:63115135-63115157 TGGTCCTTGTAAATGGTAGGAGG - Intergenic
1121955185 14:98207056-98207078 GGGTGCCTGAAAGTGCCTGGAGG - Intergenic
1122025049 14:98869598-98869620 GGGAGCTTTAAAATGCTTGGGGG + Intergenic
1126192909 15:45897671-45897693 GGTTCCTAGAAAATGCTATGGGG - Intergenic
1131937393 15:97521943-97521965 AGCTGTTTGAAAATGCTAGGTGG - Intergenic
1133656000 16:7864707-7864729 GGGTGCTTGAGAAAGGTAGTTGG - Intergenic
1134047548 16:11112192-11112214 GAGTGCTTGAAAATGCACAGTGG + Intronic
1139509681 16:67420013-67420035 AGATGCTGGAAAAGGCTAGGGGG + Intergenic
1141505806 16:84477599-84477621 GGGCCCTAGAAAGTGCTAGGAGG - Exonic
1143513196 17:7406888-7406910 GGTTGCTTGAAATTGCTGGAGGG + Intronic
1144367565 17:14559329-14559351 TAGTGCTGGCAAATGCTAGGTGG + Intergenic
1146542512 17:33709830-33709852 AGGTGCTTAAAAATGTTAAGTGG - Intronic
1148018566 17:44539182-44539204 GGGTGCTTGAGAAGGGGAGGAGG - Intergenic
1149028642 17:52059409-52059431 GGGTTCTGGAAAATGCTCAGTGG - Intronic
1154402617 18:14056020-14056042 GGGTGTTTGTACATGCTAGGCGG - Intergenic
1155327102 18:24675587-24675609 GGGTGCTGGAAAAGCCCAGGGGG - Intergenic
1157114471 18:44850296-44850318 GGGTGCATGTCAATGCTGGGTGG - Intronic
1157813455 18:50714515-50714537 GGATGCAGGAAAATGCTATGTGG - Intronic
1161272018 19:3395056-3395078 GGTTGCTTGAAAATCCAAGGAGG + Intronic
1162760908 19:12887620-12887642 GGGTGTCTGATAATGCTTGGCGG - Intergenic
1164830381 19:31315441-31315463 GGGTGCTGGATACTGCCAGGTGG + Intronic
928854619 2:35789350-35789372 GAGTGCTTGAGAATGCCAGTCGG + Intergenic
929246561 2:39709189-39709211 GGGTGGTTGAACATGCCAGAGGG - Intronic
935492352 2:103735809-103735831 GGGTGCATGAAAATACATGGTGG + Intergenic
935665932 2:105512585-105512607 GGAGGCTTGAAAATGCAAGAAGG - Intergenic
936904366 2:117519996-117520018 GTGTGCATGAAAATGATAAGGGG + Intergenic
937469960 2:122166223-122166245 GGTTGGTTGAAAATGCAATGTGG - Intergenic
938011526 2:127832645-127832667 GAGCGCTTGAGAATGCCAGGAGG + Intergenic
940186236 2:150986996-150987018 GGGTGCTTGGAAAGGCTGTGGGG - Intergenic
940523913 2:154787193-154787215 GTGTTATTGAAAATGCGAGGAGG - Intronic
944808695 2:203307473-203307495 GGGTGCTAGAAGATTCAAGGTGG - Intergenic
945020308 2:205564384-205564406 GGGTGTTTGAATTTGCTAAGAGG - Intronic
947045550 2:225978846-225978868 GGTTGTATGAAAATGCAAGGAGG - Intergenic
1174398473 20:50262433-50262455 GGGTGATTGAAAATGTTTTGGGG - Intergenic
1180133338 21:45842783-45842805 GGGTGCTTGGTACTGCTGGGTGG + Intronic
1182111650 22:27727826-27727848 GGGTGCTTGAAAAAACAAAGAGG + Intergenic
1182133662 22:27880020-27880042 GTGTGCTTCAAAATGGTAGCAGG - Intronic
950234536 3:11307338-11307360 GGCTGCTTCAAAATGCTGGCTGG - Intronic
953845168 3:46421018-46421040 GAGTGCCTGAGAATGCCAGGAGG - Intergenic
954973695 3:54673370-54673392 GTGTGCTTGAAAATTCCAAGAGG + Intronic
960406531 3:117267432-117267454 GTGTCATTGAAAATGCAAGGTGG - Intergenic
961095552 3:124152942-124152964 AGGTGCTTCAAAAGGCAAGGAGG - Intronic
968956713 4:3723231-3723253 GGGTGCTTCATAAAGCAAGGAGG - Intergenic
970018076 4:11534967-11534989 GGGTCCTTAAAAATGAAAGGAGG + Intergenic
971250220 4:24968204-24968226 GGGTGCTTGAAAATGCTAGGAGG + Intronic
973220166 4:47717189-47717211 GGTTGCTTGAAAAAGCCTGGAGG - Intronic
975294584 4:72718267-72718289 GTGTGCTTGAAAATGCTAAGAGG + Intergenic
976339355 4:83929134-83929156 GGGTGCTGGAAATTACTATGGGG - Intergenic
982037032 4:151355949-151355971 GGGTGCTTGGAGATGATAGCTGG + Intergenic
985035050 4:185830394-185830416 GGGTGATTCAAAGAGCTAGGTGG - Intronic
987444686 5:18003208-18003230 GGGTATTTGAAAATGCAAGCTGG + Intergenic
992074163 5:73175705-73175727 GGGTGGGTGAAAATGGCAGGGGG - Intergenic
1000142265 5:158416961-158416983 GGGGGCTTGACAGTGCAAGGTGG + Intergenic
1001162213 5:169330115-169330137 GGGTCCTTAAAAATGGTAGCGGG - Intergenic
1003060176 6:2856867-2856889 AGGAGTTTCAAAATGCTAGGAGG + Intergenic
1006089011 6:31616731-31616753 GGGTGCTAGGAAAGGCTAGAAGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008106135 6:47442768-47442790 GGGTGTTTAAACATGCTAGGTGG - Intergenic
1008455260 6:51703469-51703491 TAGTGCTTGAGACTGCTAGGGGG - Intronic
1009712913 6:67347748-67347770 GAGTGCTTGAGAATGCCAGTAGG + Intergenic
1012174796 6:96067540-96067562 GGTTGCTTGAAAAAGCAAAGGGG + Intronic
1018853023 6:167654873-167654895 GGGTGCTGGAAAATGCCTAGTGG + Intergenic
1020251190 7:6469808-6469830 GGGTGATTAAAAAAGCTGGGGGG - Intronic
1022293875 7:29031097-29031119 GGCTTCATGAAAATCCTAGGGGG - Intronic
1022330815 7:29377112-29377134 GGGGGCTTGAAACTGGGAGGCGG - Intronic
1023198881 7:37672022-37672044 GAGTGCTGGCAAATGCAAGGAGG + Intergenic
1023762900 7:43483394-43483416 GGGTGTGTGGAAATGCTGGGGGG - Intronic
1024425377 7:49219540-49219562 AGGTGCTTGAAAAGACTATGTGG - Intergenic
1026847712 7:73707031-73707053 GGGTTCTTGAAGATGCCAGTGGG + Intronic
1030632034 7:111906704-111906726 GGGTCCTTGAAAAAGGGAGGGGG + Intronic
1031891843 7:127303436-127303458 GGTTGATTGAAAATGCCTGGTGG - Intergenic
1032552877 7:132802178-132802200 GGGTCCTTGGAAATGATGGGGGG + Intronic
1034082960 7:148297544-148297566 GGGTGCTAGAAAGTGCTATTCGG + Intronic
1034677698 7:152903333-152903355 AGGTGCTTGAATATTCCAGGAGG + Intergenic
1036955842 8:13187456-13187478 GGTATCTTGAAAATGCTAGGTGG + Intronic
1037511614 8:19588933-19588955 GGGTGTTTGAAAATGTGTGGGGG + Intronic
1038756182 8:30342993-30343015 AGTTGCTTGAAGGTGCTAGGCGG - Intergenic
1039931473 8:41994570-41994592 GGTTGCTTTGAAATGCTAGATGG - Intronic
1040849733 8:51887071-51887093 GGGTCCTTAAAAATGGAAGGAGG - Intronic
1041495203 8:58478557-58478579 GAGTGCTTTGAAATGCTAGATGG - Intergenic
1055199903 9:73647019-73647041 GGTTGCTTGACATTGCTAGTGGG + Intergenic
1056533939 9:87511540-87511562 GGCTGCTTGGAAATGCTTTGAGG + Intronic
1058320946 9:103629966-103629988 GGGTGCCTACAAATGCCAGGTGG + Intergenic
1186752495 X:12635582-12635604 GGGGGGTGGAATATGCTAGGAGG + Intronic
1187085215 X:16035573-16035595 GGGTATTTGTAAATTCTAGGTGG - Intergenic
1191136562 X:57070491-57070513 GAGCGCTTGCAAAAGCTAGGAGG + Intergenic
1194800250 X:98264188-98264210 GGGTGCATGAAAATGCATGGTGG - Intergenic
1195591980 X:106640042-106640064 GGGTGTTTTAAATTTCTAGGTGG + Intronic
1197426397 X:126302194-126302216 TGGGGCCTGAAAATGCTAGAAGG - Intergenic
1200905168 Y:8474309-8474331 GGCTGATTGTAAAAGCTAGGTGG + Intergenic