ID: 971250730

View in Genome Browser
Species Human (GRCh38)
Location 4:24971247-24971269
Sequence GAGAGCAACAACTCACTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 8, 2: 12, 3: 14, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971250730_971250733 7 Left 971250730 4:24971247-24971269 CCTAGTAGTGAGTTGTTGCTCTC 0: 1
1: 8
2: 12
3: 14
4: 127
Right 971250733 4:24971277-24971299 TTGTTGTGGGTTATGAATTCAGG No data
971250730_971250732 -6 Left 971250730 4:24971247-24971269 CCTAGTAGTGAGTTGTTGCTCTC 0: 1
1: 8
2: 12
3: 14
4: 127
Right 971250732 4:24971264-24971286 GCTCTCTGTGTTGTTGTTGTGGG 0: 2
1: 7
2: 8
3: 122
4: 3256
971250730_971250731 -7 Left 971250730 4:24971247-24971269 CCTAGTAGTGAGTTGTTGCTCTC 0: 1
1: 8
2: 12
3: 14
4: 127
Right 971250731 4:24971263-24971285 TGCTCTCTGTGTTGTTGTTGTGG No data
971250730_971250736 22 Left 971250730 4:24971247-24971269 CCTAGTAGTGAGTTGTTGCTCTC 0: 1
1: 8
2: 12
3: 14
4: 127
Right 971250736 4:24971292-24971314 AATTCAGGGCTCTGCCCTATGGG No data
971250730_971250734 8 Left 971250730 4:24971247-24971269 CCTAGTAGTGAGTTGTTGCTCTC 0: 1
1: 8
2: 12
3: 14
4: 127
Right 971250734 4:24971278-24971300 TGTTGTGGGTTATGAATTCAGGG 0: 2
1: 10
2: 9
3: 29
4: 183
971250730_971250735 21 Left 971250730 4:24971247-24971269 CCTAGTAGTGAGTTGTTGCTCTC 0: 1
1: 8
2: 12
3: 14
4: 127
Right 971250735 4:24971291-24971313 GAATTCAGGGCTCTGCCCTATGG 0: 1
1: 4
2: 10
3: 25
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971250730 Original CRISPR GAGAGCAACAACTCACTACT AGG (reversed) Intronic
901957717 1:12798340-12798362 GAGAGGAACTACCCACTACTGGG + Intergenic
901957727 1:12798448-12798470 GAGAGCAGCAACCCACTCCAGGG + Intergenic
901965724 1:12864200-12864222 GAGAGCAGCAACCCACTCCAGGG + Intronic
901977258 1:13005023-13005045 GAGAGCAAGAAGTTAGTACTGGG - Intronic
901981124 1:13034578-13034600 GAGAGCAGCAACCCACTCCAGGG + Intronic
902000963 1:13194352-13194374 GAGAGCAGCAACCCACTCCAGGG - Intergenic
902004828 1:13223911-13223933 GAGAGCAAGAAGTTAGTACTGGG + Intergenic
902020193 1:13340056-13340078 GAGAGCAGCAACCCACTCCAGGG - Intergenic
902024046 1:13369646-13369668 GAGAGCAAGAAGTTAGTACTGGG + Intronic
908445112 1:64192313-64192335 GAGAGCAATAGCTCACTACTAGG - Intergenic
910123877 1:83819402-83819424 CAGAGCAACCACTCACTAGAGGG + Intergenic
910360368 1:86409752-86409774 GACAGCAACAGCTCACTACTAGG + Intergenic
911237263 1:95424941-95424963 TAGAGCAAGAACTCATTTCTGGG + Intergenic
922687605 1:227656916-227656938 GATAGTAACAATACACTACTGGG + Exonic
923956126 1:239023666-239023688 GAAAGCAAAAAGTCACTAATAGG + Intergenic
924493090 1:244559101-244559123 GAGAGTGAAAACTCACTTCTTGG + Intronic
1069735536 10:70651642-70651664 GAGAGCAACAGCTCACTACTAGG - Intergenic
1071880295 10:89889763-89889785 TAGAGCGAGAACTCACTACCAGG - Intergenic
1071995028 10:91139292-91139314 GAAAGCAACAACTTATTCCTTGG - Intergenic
1073895859 10:108156611-108156633 GAGAGCTACAATTCAATATTGGG + Intergenic
1074038836 10:109768096-109768118 GAGAGCAACATATCACATCTAGG + Intergenic
1074287649 10:112113497-112113519 GAGAGGGTCAAATCACTACTAGG + Intergenic
1080412243 11:32036737-32036759 CAGAGCAAAAACTAAGTACTGGG + Intronic
1081127525 11:39340207-39340229 GACAGCAACAGCTCACTGCTAGG + Intergenic
1081343279 11:41953425-41953447 GTTAGAAACAACTCATTACTGGG + Intergenic
1085136848 11:74098201-74098223 GACAGCAACAACTGGGTACTGGG + Exonic
1085182011 11:74543948-74543970 GAGAGCAATAGCTCACTACTAGG - Intronic
1086383087 11:86279352-86279374 AGGGGCAACAACTCACTACATGG - Intergenic
1087674002 11:101138108-101138130 GAGAGCCAGAACTCACTACTAGG + Intergenic
1087891345 11:103541585-103541607 GAGAGCAATACCTCACTACTAGG + Intergenic
1094705707 12:32912519-32912541 GTGAGAACCTACTCACTACTGGG + Intergenic
1098035390 12:66296431-66296453 GAGAGCAACATGTCACTTCAGGG - Intergenic
1099574030 12:84359019-84359041 GAGAGCAACAGCTCAATACTAGG - Intergenic
1104195850 12:126537192-126537214 CAGAGCCACAACTCTCTGCTTGG - Intergenic
1109525277 13:63566726-63566748 GAGAGGAACTACTCACTCCAGGG + Intergenic
1109908090 13:68872237-68872259 GATAGCAACAATGCACCACTAGG + Intergenic
1111611521 13:90613863-90613885 GAGAGCAACAGCTCACTACTAGG + Intergenic
1112593204 13:100783352-100783374 GAGATCAACAAAGCACAACTTGG - Intergenic
1113448742 13:110390468-110390490 GAGTGCAACACATCACCACTCGG - Intronic
1113499950 13:110765364-110765386 GTGAGCATCCACTCACTACCGGG - Intergenic
1118460611 14:65983855-65983877 GAGAGCACCAACTCAGTAAGTGG + Intronic
1127869644 15:63060707-63060729 GAGAGAAGCAACTCTCTATTAGG - Intronic
1144152726 17:12465734-12465756 GAGAGGAACCACTCCCTACATGG - Intergenic
1144266610 17:13575467-13575489 GAGAGCAAAAACTCCCTGATTGG - Intronic
1147376290 17:40024087-40024109 CAGAGCAAAAGCTCCCTACTTGG + Intronic
1150184326 17:63164070-63164092 AAGAAAAACAAATCACTACTGGG + Intronic
1150691161 17:67368212-67368234 GTGAGCAACAAGCCACTTCTTGG + Intergenic
1156260722 18:35443288-35443310 GAGAGCCACGACTCATTCCTGGG + Intergenic
1160212898 18:76897829-76897851 GGGAGCAATAATTGACTACTTGG + Intronic
1166788806 19:45385483-45385505 GGGAGCAACTACCCCCTACTAGG - Intronic
925273341 2:2630970-2630992 GAAGGCAACATCTCACTTCTAGG + Intergenic
930618613 2:53621122-53621144 GTGAGCATGACCTCACTACTCGG + Intronic
931298913 2:60957691-60957713 GAGAGCAACAGATCACCACTAGG - Intronic
933025380 2:77251406-77251428 GAGAACAAGAAGTCACTACATGG + Intronic
933089773 2:78106145-78106167 GACAGCAACAGCTCACTAACAGG + Intergenic
937760962 2:125603243-125603265 TAGAGCAGCACCTCACTACCTGG - Intergenic
939225942 2:139364290-139364312 GAAAGAAAGAACTCACTCCTGGG - Intergenic
939932602 2:148254074-148254096 GAGAGGAACAGCTCACTACTAGG + Intronic
941425266 2:165336590-165336612 GGGAGCAACAACTAACTAATGGG + Intronic
941633522 2:167910129-167910151 GAGAGTAAAAAATCACTAGTTGG - Intergenic
943320558 2:186437704-186437726 GAGAGCAACAGCTCACTACTAGG - Intergenic
943647724 2:190425945-190425967 GAGAGAAACAACTTACCAATGGG - Intronic
944391468 2:199224189-199224211 GAGAGCAACAGCTCACTACTAGG + Intergenic
947341607 2:229146297-229146319 GAGAGGAACAACACACTCCAGGG + Intronic
1170036658 20:11996804-11996826 TAGAGCAGGAACTCACAACTTGG + Intergenic
1170107699 20:12769125-12769147 GAGAACAACAAAACACTGCTTGG + Intergenic
1170840188 20:19919021-19919043 GAGAGCAACAATTCACTGCGGGG - Intronic
1175291810 20:57881042-57881064 GAAATCCACAACTCTCTACTTGG + Intergenic
1178093029 21:29184110-29184132 GAAAGCAAGAACTCACTACCTGG - Intergenic
1178260269 21:31093351-31093373 TAGAGCAAGAACTCATTACCAGG - Intergenic
1179437118 21:41369637-41369659 CAGAGCAGCACCTCACTTCTCGG - Intronic
1181443680 22:22952147-22952169 GAGACCAATAACTCACTCCCAGG - Intergenic
1181615540 22:24051770-24051792 GAGAGCAACATCTCTCTCATAGG + Intronic
953844672 3:46417984-46418006 GAGAGCAACAGCTCACGACTAGG + Intergenic
958525040 3:95246445-95246467 GAGATTATCAACTCACTAATTGG - Intergenic
960039828 3:113139650-113139672 GAGACCAGCAACTCAGCACTGGG + Intergenic
960719435 3:120611310-120611332 GAAAGGACCAACTCACTTCTGGG - Intergenic
960988825 3:123297337-123297359 AGGAGCATCAACTCACCACTGGG + Exonic
964433223 3:156626121-156626143 GAGAGCAACAGCTCACTACTAGG - Intergenic
965380413 3:167981309-167981331 GAGAGCCACAACTTAAAACTAGG - Intergenic
966840182 3:184081730-184081752 GAGAGGAACTACTCACTCCAGGG + Intergenic
968538634 4:1150934-1150956 GAGAGCAACAGCCCACTCCAGGG - Intergenic
969763200 4:9206323-9206345 GAGAGGAACAACACACAACACGG + Intergenic
971250730 4:24971247-24971269 GAGAGCAACAACTCACTACTAGG - Intronic
971938777 4:33188530-33188552 GAGAGGAGCAACTCACTACAGGG - Intergenic
974619874 4:64340929-64340951 GAGAGGAACAACCCACTCCAGGG + Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975792631 4:77971149-77971171 GAGGGAAACAACACACAACTGGG + Intergenic
975939758 4:79628569-79628591 GAGAACAACTGCTCACTAATGGG + Intergenic
977574916 4:98665341-98665363 GAAAGCAACACCTCACTACTAGG + Intergenic
978016870 4:103754838-103754860 GAGAACAACAGGTCACTGCTAGG - Intergenic
979082621 4:116361755-116361777 GAGAGCAACAGCTCACTACTAGG - Intergenic
979510140 4:121544460-121544482 GAGAGACAGAACTCAATACTAGG - Intergenic
979670943 4:123359671-123359693 GAGAGCCACAGCTCACTATCAGG + Intergenic
986547795 5:8918097-8918119 GAGGACAGCATCTCACTACTAGG + Intergenic
986547835 5:8918369-8918391 GAGGACAGCATCTCACTACTAGG + Intergenic
986547845 5:8918437-8918459 GAGGACACCATCTCACTACTAGG + Intergenic
986547857 5:8918505-8918527 GAGGACAGCATCTCACTACTAGG + Intergenic
986634508 5:9807978-9808000 TAGAGCAACACCCCACTTCTTGG - Intergenic
987762865 5:22188173-22188195 GAGAGTGGGAACTCACTACTAGG - Intronic
991115502 5:62950067-62950089 GATTGCTACAACTCAGTACTAGG - Intergenic
991586145 5:68203791-68203813 GAAAGCAACAACTTTCTATTTGG - Intergenic
991897651 5:71421571-71421593 GAGAGTGGGAACTCACTACTAGG - Intergenic
992434980 5:76747572-76747594 GAGGGCAAGAACTCACTACCAGG - Intergenic
993589248 5:89774000-89774022 GAGAGCAAAAACTCCCTATTGGG - Intergenic
994980798 5:106873985-106874007 GAGAGCAACAGCTCACTACTAGG + Intergenic
995361160 5:111299015-111299037 AAGAGCAACAGCTCACTACTAGG - Intronic
995559551 5:113365588-113365610 TATAGCAACACCCCACTACTTGG + Intronic
996667648 5:126079451-126079473 GTGAGCATCAACTCAGAACTAGG + Intergenic
997600238 5:135134042-135134064 GAGAGGAACAAGTCACCACGTGG - Intronic
997893933 5:137699120-137699142 GGGAGCAACAAATCTCTCCTGGG + Intronic
999296770 5:150464628-150464650 GAGAGCAGCAACTCAGGGCTGGG - Intergenic
999986349 5:157008867-157008889 TATAGCAACACCTCACTCCTTGG + Intergenic
1001184577 5:169556590-169556612 TAGAGTAAGAACTCATTACTGGG - Intergenic
1001369974 5:171189689-171189711 GAGAGCAACAAGAGACTAATCGG - Intronic
1007649989 6:43413282-43413304 GAGAGGAGCAACTCACTCCAGGG + Intergenic
1008117731 6:47571746-47571768 GAGAGAAAGAACTCAATTCTTGG - Intronic
1010019933 6:71147524-71147546 GAGATGAAAAACTCACTGCTGGG - Intergenic
1010723277 6:79308016-79308038 GAGAGCAACAGCTCACTACTAGG + Intergenic
1011450735 6:87489317-87489339 GAGAGCCACAGCTCACTACCAGG - Intronic
1012242511 6:96889816-96889838 GACAGAAAAAACACACTACTAGG + Exonic
1013693090 6:112668156-112668178 GAGAGGAACAACCCACTCCAGGG + Intergenic
1014289320 6:119539994-119540016 GAGAGGAGCAACTCACTACAGGG + Intergenic
1014752042 6:125267791-125267813 GAGAGCGACAGCTCACTACTAGG - Intronic
1014753043 6:125274003-125274025 GAGAGCAACAGCTCATTACCAGG - Intronic
1015337753 6:132060844-132060866 GAGAGCAGCAGTTCATTACTTGG + Intergenic
1015937968 6:138421485-138421507 GAGAGAAACAAATTACTGCTTGG - Exonic
1017211439 6:151861609-151861631 CAGATGAACAACTCACTTCTGGG - Intronic
1017406139 6:154121273-154121295 GAGAAAAACCACTAACTACTTGG - Intronic
1017898858 6:158703709-158703731 GAGAGCAACAGCCCACAACTGGG + Intronic
1018662695 6:166102857-166102879 TATAGCAACACCTCACTCCTTGG + Intergenic
1023636287 7:42214117-42214139 GAGAGAAAAGCCTCACTACTTGG - Intronic
1023855621 7:44181845-44181867 GAGACCAACCAGCCACTACTGGG + Intronic
1024642901 7:51345824-51345846 GAGAGAAACAACCCACAAGTAGG + Intergenic
1027684397 7:81264500-81264522 GAGAGCAACAGCTCACTACCTGG + Intergenic
1033737221 7:144234439-144234461 GAGGGGAACAACACAGTACTGGG + Intergenic
1033745836 7:144316507-144316529 GAGGGGAACAACACAGTACTGGG - Intergenic
1036864649 8:12384883-12384905 GAGAGGAACAACACACAACACGG - Intergenic
1041658856 8:60381246-60381268 CAGAGTAAAAACTCACTATTAGG + Intergenic
1042024501 8:64408343-64408365 GAGAGCAAAAACAAAATACTGGG - Intergenic
1042330243 8:67572344-67572366 AAAAGCAAGAACTTACTACTAGG - Intronic
1043966183 8:86479271-86479293 GAGAGAATCAACCCACTACCTGG - Intronic
1045803798 8:106133130-106133152 CAGAGCAAGAACTCATTACTGGG - Intergenic
1046656853 8:116904435-116904457 CAGAGCAACAACTCTGTACCAGG - Intergenic
1048500969 8:134974727-134974749 CCTAGCAACAACTCACTAATGGG + Intergenic
1048563304 8:135566203-135566225 GAGAGCAACAACTCAATCGAGGG - Intronic
1050484010 9:6114861-6114883 GAGAGGAACTACTCACTCCAGGG + Intergenic
1051102939 9:13542959-13542981 GATTGCAAGAACTCACAACTGGG - Intergenic
1055108832 9:72539764-72539786 TACAGCAACATTTCACTACTTGG + Intronic
1055336216 9:75235993-75236015 AAGAATAACAGCTCACTACTAGG + Intergenic
1055538105 9:77270118-77270140 TTAAGCAACAACTCACTGCTTGG - Intronic
1057134014 9:92673916-92673938 TAGAGTAAGAACTCATTACTTGG - Intergenic
1057642134 9:96834770-96834792 TAAAGCAACAACCCACTCCTTGG - Intronic
1059257862 9:112947228-112947250 GAGAGCAGCAACTCAATGGTGGG + Intergenic
1062184754 9:135211984-135212006 GAGAGGAACAACCCACTCCAGGG + Intergenic
1186378199 X:9031590-9031612 GAGAGGAACAACAGACAACTGGG + Intronic
1187234833 X:17457481-17457503 TAGAGTAAGAACTCACTCCTGGG + Intronic
1187915861 X:24151292-24151314 GAGAGGTACAACTAATTACTGGG + Intronic
1188213848 X:27454309-27454331 AAGAGCAACAACCTAGTACTTGG + Intergenic
1188836997 X:34970388-34970410 GGGAGCAGCAACTAACTACATGG + Intergenic
1197324021 X:125069570-125069592 GAGAGAAACAACACACTCCGGGG + Intergenic
1200063699 X:153494996-153495018 GAAAGCAGCTACTCACTCCTGGG - Exonic