ID: 971252333

View in Genome Browser
Species Human (GRCh38)
Location 4:24983855-24983877
Sequence CAGGCAATTGATGCTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971252333_971252337 -4 Left 971252333 4:24983855-24983877 CCCAAGCCAGCATCAATTGCCTG No data
Right 971252337 4:24983874-24983896 CCTGCAACCTAGAGCACTAATGG No data
971252333_971252341 19 Left 971252333 4:24983855-24983877 CCCAAGCCAGCATCAATTGCCTG No data
Right 971252341 4:24983897-24983919 CTGCAGCTGGGAGTTAGTAAAGG No data
971252333_971252340 7 Left 971252333 4:24983855-24983877 CCCAAGCCAGCATCAATTGCCTG No data
Right 971252340 4:24983885-24983907 GAGCACTAATGGCTGCAGCTGGG No data
971252333_971252339 6 Left 971252333 4:24983855-24983877 CCCAAGCCAGCATCAATTGCCTG No data
Right 971252339 4:24983884-24983906 AGAGCACTAATGGCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971252333 Original CRISPR CAGGCAATTGATGCTGGCTT GGG (reversed) Intergenic
No off target data available for this crispr