ID: 971254338

View in Genome Browser
Species Human (GRCh38)
Location 4:25000619-25000641
Sequence GATCCCTCTGTGCGGCCATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971254338 Original CRISPR GATCCCTCTGTGCGGCCATG TGG (reversed) Exonic
900710039 1:4107853-4107875 GAGCCTTCTGTGTGGCCAGGAGG + Intergenic
907975518 1:59427693-59427715 AACCCCTCTGTGCAGCCTTGAGG + Intronic
911229387 1:95344660-95344682 GCTTCCTCTCTGTGGCCATGAGG + Intergenic
918142452 1:181731061-181731083 GAGTCCTCTGTGTGGCCATCAGG - Intronic
921943642 1:220870863-220870885 GAGCCCCCTATGCAGCCATGTGG + Intergenic
1069419450 10:68233704-68233726 GCTCCCTCTGTGCTGCTCTGTGG + Intergenic
1069632371 10:69904706-69904728 TGTCCCTCTTTGCAGCCATGTGG - Intronic
1069908032 10:71743537-71743559 GATGACACTGTGCAGCCATGGGG - Intronic
1075871526 10:125774933-125774955 CCTCCCGCTGTGCGGCCATGAGG - Intronic
1076248328 10:128964941-128964963 GTTCTCTCTGTGCAGCCATGGGG + Intergenic
1076761662 10:132608850-132608872 GGGCCCTCTGTGAGGGCATGGGG + Intronic
1081735726 11:45402181-45402203 GAGGCCTCTGAGCTGCCATGAGG - Intergenic
1082167456 11:48965175-48965197 GAGACCTCTGTGAGGCAATGTGG - Intergenic
1090645603 11:128764727-128764749 AAGCCCTGCGTGCGGCCATGGGG - Intronic
1091174701 11:133547535-133547557 CATCCCACAGTGCTGCCATGAGG + Intergenic
1094249978 12:28348431-28348453 TATCCCTGTGTGCTGCCTTGGGG - Intronic
1101289294 12:103351379-103351401 GAGGCTTCTGTGCAGCCATGTGG - Intronic
1102886801 12:116528299-116528321 AATCCTTCTGTGAGTCCATGGGG + Intergenic
1103973975 12:124689969-124689991 GTTCCCTGTCTGGGGCCATGAGG + Intergenic
1104964366 12:132502364-132502386 GATTCCTCTGGGTGGCCATAAGG - Intronic
1112367869 13:98771282-98771304 GATCCTTCTGTGTGCCCATTAGG - Intergenic
1116018214 14:39431967-39431989 GATGGCTCTGTGCGGGCAGGCGG - Exonic
1130063281 15:80584702-80584724 GTGCCCTCTGTGCAGCCCTGGGG + Intronic
1137440987 16:48498350-48498372 GATCCCTCTGTGCCACCACGTGG + Intergenic
1141393583 16:83684946-83684968 GAACCCTGTGTGGGGCCGTGTGG - Intronic
1141639333 16:85332481-85332503 GATCCCGCTGTGTGACCTTGGGG - Intergenic
1147459982 17:40562164-40562186 CATCCTTCTGTGCGGCCACTGGG + Intronic
1148029637 17:44610534-44610556 ATTCCCTCTGTGCCTCCATGGGG - Intergenic
1148669969 17:49403029-49403051 GACCCCTCTCTGTGGCCAGGTGG + Intronic
1152210110 17:78998641-78998663 GATGGCTCAGTGCAGCCATGGGG + Intronic
1152225478 17:79090699-79090721 GCTCCCTCGGTGCGGGCGTGTGG + Intronic
1152770106 17:82162561-82162583 GACCCCTCTGAGCGGGCAGGTGG + Intronic
1152770122 17:82162619-82162641 GACCCCTCTGAGCGGGCAGGTGG + Intronic
1152770138 17:82162677-82162699 GACCCCTCTGAGCGGGCAGGTGG + Intronic
1152770154 17:82162735-82162757 GACCCCTCTGAGCGGGCAGGTGG + Intronic
1152770170 17:82162793-82162815 GACCCCTCTGAGCGGGCAGGTGG + Intronic
1152770186 17:82162851-82162873 GACCCCTCTGAGCGGGCAGGTGG + Intronic
1153248716 18:3098852-3098874 GAACCCTCTATGCCACCATGTGG - Intronic
1154205622 18:12334395-12334417 GAGCCCTCTGTGAGGCACTGAGG - Intronic
1159988691 18:74876678-74876700 GGTCCTTCTGTGTGACCATGTGG - Intronic
1160534514 18:79585038-79585060 CATCCCTATGTGCTCCCATGTGG + Intergenic
1166784989 19:45362379-45362401 CATTCCTCTGTGAGCCCATGGGG - Intronic
1168184530 19:54690834-54690856 GTTCCCTCTCTGTGTCCATGAGG - Intronic
928136918 2:28694760-28694782 GATCACTCTGGGCAGCCCTGTGG + Intergenic
930145955 2:48004574-48004596 GTTCCCTCTGTGCACGCATGAGG - Intergenic
938383052 2:130847362-130847384 GATGCCTCTGGGTGCCCATGAGG - Intronic
1168983810 20:2030178-2030200 GATCCCTCTTTGCCACCATGTGG - Intergenic
1170556858 20:17521852-17521874 GGTCCCTCTGAGGGACCATGTGG + Intronic
1174950062 20:55033236-55033258 GGTCCCTCTGTGTGACCAAGGGG + Intergenic
1175700156 20:61131048-61131070 CATCCTTCTGTGAGGCCAGGGGG - Intergenic
1176869737 21:14075198-14075220 GGCACCTCTCTGCGGCCATGGGG - Intergenic
1180003582 21:45007806-45007828 GATCCGTCTGTGCTGCTGTGTGG + Intergenic
1182280938 22:29217349-29217371 GCTCCCTCTGTGGGGCCTTCAGG + Intronic
1184109328 22:42385650-42385672 AATGCCTCTGTGTGTCCATGGGG + Intronic
1185111465 22:48902405-48902427 GATCCCACTGATGGGCCATGAGG + Intergenic
1185134199 22:49059745-49059767 AATCCCTCTGTGAGGCACTGTGG + Intergenic
951408582 3:22332328-22332350 GAGCCCTCTTTGAGGCCATCTGG - Intronic
952886958 3:38017916-38017938 GCACCCTGTGTGCGGCCGTGTGG - Intronic
960121071 3:113948598-113948620 GAGCCCCCTGTGTGGCCAGGCGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968523649 4:1045791-1045813 CATCCCTCTGCGGGGACATGGGG + Intergenic
968571147 4:1341475-1341497 GGTCCCTTTCTGGGGCCATGGGG - Intergenic
968662512 4:1804610-1804632 GAGCCCTCTCTGCAGCCAGGCGG + Intronic
969112090 4:4850508-4850530 AATCCCTGTGTGTGGCCATGGGG - Intergenic
969715366 4:8865735-8865757 GCTCCCTGTTGGCGGCCATGAGG - Intronic
971254338 4:25000619-25000641 GATCCCTCTGTGCGGCCATGTGG - Exonic
992426810 5:76666204-76666226 TTTCCTTCTGTGCCGCCATGTGG - Intronic
998094817 5:139391177-139391199 GACCCCTCTGTGTGGCCAGAAGG - Exonic
1000287052 5:159835940-159835962 GATACCTCTGTGAGGCCAAATGG + Intergenic
1002426958 5:179182156-179182178 GAGCCCTCTGTGTGCCCCTGTGG + Intronic
1007177454 6:39906596-39906618 GATCCCTCTGTGCCACCACGTGG - Exonic
1007850826 6:44801235-44801257 AGTCCCTCTGTGAGGCCAGGGGG + Intergenic
1014160046 6:118157361-118157383 GATACCACTGTGCGGTCAGGAGG + Intronic
1023632035 7:42174734-42174756 TCACCCTCTGTGCGGCCCTGGGG - Intronic
1029443491 7:100600797-100600819 AGTCCTTCTGTGCGGCCATCAGG - Exonic
1029505433 7:100961003-100961025 TATCCCTCTGTGGGGCCTGGAGG + Intronic
1030513973 7:110518840-110518862 ACTCCCTCTGTGTGGCCCTGTGG - Intergenic
1030674497 7:112370400-112370422 GTTGCCTCTGGGTGGCCATGAGG - Intergenic
1035669776 8:1408476-1408498 GGTCCCTCTGCAGGGCCATGGGG - Intergenic
1036706476 8:11050766-11050788 CATCCGTCTGTGGGGACATGAGG - Intronic
1044599788 8:93992079-93992101 AACCCCTCTGTGCTGCCACGTGG - Intergenic
1048879579 8:138861299-138861321 GGTCCCTCTGTGTAGCTATGGGG - Intronic
1056571965 9:87824601-87824623 GGTCCCTCTGTGGGGCTGTGGGG - Intergenic
1061275826 9:129568980-129569002 GATCCCTCGGTGGGGCCGCGGGG - Intergenic
1062400047 9:136368391-136368413 GATCCAGCTGTGCCCCCATGGGG - Intronic
1185558799 X:1042788-1042810 TATCTCTCTGTGCTGCCAAGGGG - Intergenic
1186501341 X:10053170-10053192 GATCTCTCTGTGGGCCCAAGAGG + Intronic