ID: 971254539

View in Genome Browser
Species Human (GRCh38)
Location 4:25002222-25002244
Sequence ACGTGGCCCCATGTGGGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971254528_971254539 18 Left 971254528 4:25002181-25002203 CCTGAGATCCCCAGCCTGCACAG 0: 1
1: 0
2: 3
3: 25
4: 296
Right 971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 104
971254533_971254539 4 Left 971254533 4:25002195-25002217 CCTGCACAGGCTGATTCCACTGC 0: 1
1: 0
2: 1
3: 24
4: 169
Right 971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 104
971254531_971254539 9 Left 971254531 4:25002190-25002212 CCCAGCCTGCACAGGCTGATTCC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 104
971254527_971254539 30 Left 971254527 4:25002169-25002191 CCTACTGATCAGCCTGAGATCCC 0: 1
1: 0
2: 1
3: 7
4: 170
Right 971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 104
971254530_971254539 10 Left 971254530 4:25002189-25002211 CCCCAGCCTGCACAGGCTGATTC 0: 1
1: 0
2: 1
3: 15
4: 232
Right 971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 104
971254532_971254539 8 Left 971254532 4:25002191-25002213 CCAGCCTGCACAGGCTGATTCCA 0: 1
1: 0
2: 2
3: 21
4: 169
Right 971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971254539 Original CRISPR ACGTGGCCCCATGTGGGTCC TGG Exonic
901416801 1:9122007-9122029 GCCTGGCCCCATGGAGGTCCTGG + Intronic
902577850 1:17389589-17389611 ACGTGGCCCCGTGCGTGTTCAGG - Intronic
903952468 1:27004401-27004423 GCATGGCCCCATGTGGGTTTGGG + Intergenic
904162997 1:28535135-28535157 AGGTGGCCTCAGGTGGGTCTGGG + Exonic
904436815 1:30504429-30504451 CTGAGGCCCCATGTGTGTCCTGG - Intergenic
910201149 1:84700352-84700374 AGGTGGCCCCATGTTGGTTCGGG - Intergenic
913270824 1:117091732-117091754 AAGTAGCCCCATGTAGTTCCTGG + Intronic
915152359 1:153844252-153844274 TCCTGGCCCCATGTGAGTTCTGG - Intronic
920502272 1:206492918-206492940 ACATGGACACAGGTGGGTCCCGG - Exonic
922542117 1:226427464-226427486 ATGTGGGCCCCTGTGGGCCCAGG - Intergenic
1074226838 10:111493319-111493341 CCCAGGCCCCATGTGAGTCCAGG + Intergenic
1074272862 10:111972120-111972142 ACTGGGATCCATGTGGGTCCTGG - Intergenic
1075064876 10:119282610-119282632 TCAAGGCCCCCTGTGGGTCCAGG + Intronic
1075415396 10:122258763-122258785 ATCTGAGCCCATGTGGGTCCTGG - Intergenic
1075864470 10:125705845-125705867 AAGGGGCCCCATGGGGGTTCTGG - Intergenic
1077273950 11:1694610-1694632 AGGTGGCTCCACGTGGCTCCGGG - Intergenic
1077317305 11:1925295-1925317 TCTTGTCCCCATGTGGGGCCCGG + Intronic
1083419857 11:62546619-62546641 CCGTGGCGCCATCGGGGTCCGGG - Intronic
1089369066 11:117941324-117941346 AGTGGGCCCCAGGTGGGTCCAGG - Intergenic
1089401450 11:118166759-118166781 AGGAGGCCCCAGGTGGGCCCTGG + Exonic
1096517905 12:52168011-52168033 ACGTGGCAGCATTTGTGTCCTGG - Intergenic
1098099899 12:67003904-67003926 ACGTGGCCCAGTGTGATTCCAGG - Intergenic
1102245453 12:111353054-111353076 GTGTGGCCCCCTGTGGGACCAGG + Intergenic
1104311355 12:127656721-127656743 ACCTAGCCCCCTGTGGGGCCTGG + Intergenic
1113936775 13:113999052-113999074 ACGAGGCGACATGTGGGTCCGGG + Intronic
1113936785 13:113999092-113999114 ACGAGGCCACACGTGGGCCCGGG + Intronic
1114401934 14:22418088-22418110 ACGTTGCCCCATGTGGTTGTTGG - Intergenic
1116677153 14:47920330-47920352 CCCTTGCCCCATGTGGATCCAGG + Intergenic
1118845096 14:69542026-69542048 ACATGGCCCCATGTGCTTGCAGG + Intergenic
1119782253 14:77284314-77284336 ACAGGGCCCCATGTGGTTCCTGG + Intronic
1120061325 14:79986337-79986359 ACTTGGAGCCATATGGGTCCTGG - Intergenic
1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG + Intergenic
1133028575 16:2999020-2999042 ACCTGGCCCTATGAGGGTCAGGG + Intergenic
1139848171 16:69935057-69935079 ACGTGCCCCGTTGAGGGTCCTGG + Intronic
1139901183 16:70329788-70329810 AGGTGGCCCCAGGTGGCCCCGGG - Intronic
1142374126 16:89698015-89698037 ACGTGGCCTCCTGTGTGGCCTGG - Exonic
1142850972 17:2704624-2704646 ACGTGTCCCCGTGTGGGGTCAGG - Intronic
1146703318 17:34980815-34980837 ACGCGGCCCCGTGGGGGTCCCGG - Intronic
1149981613 17:61315655-61315677 ATGCTTCCCCATGTGGGTCCTGG + Intronic
1150003262 17:61455032-61455054 ACGTGGCCCGAGGCGGGTGCTGG + Intronic
1150285575 17:63951938-63951960 AGGTGGCACCCTCTGGGTCCCGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150882288 17:69043843-69043865 ATCTGGCCCCTTGTGGTTCCTGG + Intronic
1151876441 17:76870061-76870083 ACGTGGCCACAGGTGGGCTCCGG + Intronic
1152227118 17:79097629-79097651 ACTTGGCCCCGTGGGGCTCCGGG - Intronic
1152392192 17:80009646-80009668 ACCTGGCCCCCTGTGGTCCCCGG - Intronic
1152814553 17:82399773-82399795 GCGTGGCCCCAGCTGGGTTCTGG - Intronic
1158938125 18:62383905-62383927 ACGTGGCCCCATGATCCTCCAGG + Intronic
1160782030 19:881917-881939 ACGTGACCCAAGGTGGGCCCTGG + Intronic
1160892956 19:1388721-1388743 CCCTGACCTCATGTGGGTCCAGG + Intronic
1161565280 19:4998429-4998451 ATGTCGCCACATGGGGGTCCTGG - Intronic
1165765226 19:38346348-38346370 GCGTGGGGCCTTGTGGGTCCAGG + Intronic
1167512123 19:49900940-49900962 ACGAGGCCCCCAGTGGGGCCAGG - Intronic
1167671226 19:50854946-50854968 CTGTGTCACCATGTGGGTCCCGG + Exonic
1168181083 19:54663547-54663569 ACCTGCCTGCATGTGGGTCCTGG - Exonic
1168309284 19:55452475-55452497 GGGAGCCCCCATGTGGGTCCCGG + Intergenic
1168508506 19:56955889-56955911 ACGTGGCCTCAGGTGGGTTGAGG - Intergenic
1168665837 19:58204209-58204231 CCGTTGCCCCATGTAGGCCCAGG + Intronic
925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG + Intergenic
926111616 2:10187602-10187624 ATCTGGCCCCATGTGGATCTTGG + Intronic
926471107 2:13259472-13259494 ACGGAGCCCCAGGTGTGTCCTGG + Intergenic
937905050 2:127049089-127049111 CCCTGGCCCCAGGTGGGTCACGG + Intronic
941218160 2:162739555-162739577 ACTGGGCCCCATGTAGGACCTGG - Intronic
942436017 2:175977266-175977288 AAATAGCCCCATGTGGCTCCTGG - Intronic
944271302 2:197786770-197786792 ACGGCGCCCCAAGCGGGTCCCGG + Intergenic
948890509 2:240904997-240905019 ACATGGCCCCATGGGCATCCGGG - Intergenic
1171209259 20:23304455-23304477 AGGTGGGGCCATGTGGGTGCAGG + Intergenic
1174555851 20:51394831-51394853 ACGTGGCCCCATTTGGGAACAGG - Intronic
1175499773 20:59441531-59441553 CCTTGGTCTCATGTGGGTCCTGG + Intergenic
1176207031 20:63894883-63894905 AGGTGGCCGCAGGTGGGTCCCGG - Intergenic
1179652573 21:42821157-42821179 CCCAGGCCCCAAGTGGGTCCAGG - Intergenic
1181007289 22:20019970-20019992 ACGGGCCCGCATGTAGGTCCAGG + Intronic
1181565346 22:23733431-23733453 CCTTGGCCCCATGCAGGTCCGGG + Intergenic
1182623806 22:31631635-31631657 GCCTGGCACCATGTGGGTACGGG - Intronic
1184343024 22:43896422-43896444 ACGTGGCCCCTAGTGCCTCCTGG - Intergenic
951309503 3:21106608-21106630 TCGTGACCTCAAGTGGGTCCTGG - Intergenic
952866020 3:37855654-37855676 ACTTGTCCCCAGGTGGGACCTGG - Intergenic
954117638 3:48475994-48476016 ATGTGGGCCCATCTGGATCCAGG + Intronic
954404303 3:50337040-50337062 ACGTGGCTCCCCGCGGGTCCTGG - Intronic
961911185 3:130318154-130318176 ACATGGGCCATTGTGGGTCCTGG - Intergenic
965743443 3:171900624-171900646 ACGTGGCCCCATCTGGTTTCAGG - Intronic
970164902 4:13226399-13226421 CCCTTGCCCCATGTGGCTCCTGG - Intergenic
970171089 4:13291122-13291144 TCCTGGCCCCAAGTGGCTCCTGG - Intergenic
971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG + Exonic
972924803 4:43990726-43990748 AAGTGGCCCCATGGTGTTCCTGG + Intergenic
977525674 4:98143080-98143102 ACTGAGGCCCATGTGGGTCCTGG - Exonic
1002495106 5:179606414-179606436 AGGTGGCCCGGTGTGGGTGCGGG + Intronic
1002541044 5:179907062-179907084 AGGTGGCCCTTTGTGGGCCCGGG - Intronic
1005093096 6:22079990-22080012 CCGTGGCCACATGTGGCTCTTGG + Intergenic
1006078306 6:31548384-31548406 CCGTGTCCCCATGGCGGTCCTGG - Exonic
1006155069 6:32009452-32009474 ACGTGCCCTCATCAGGGTCCTGG + Intergenic
1006161380 6:32042187-32042209 ACGTGCCCTCATCAGGGTCCTGG + Intronic
1006191233 6:32210806-32210828 ACGTGAACCCATGTGAGTCCAGG - Exonic
1006519964 6:34565526-34565548 AGGTGTCCACATGTGGATCCTGG - Intergenic
1012047840 6:94301208-94301230 CCCTGGCCCCGGGTGGGTCCAGG - Intergenic
1021776439 7:24059457-24059479 CCCTTGCCCCATGTGGCTCCCGG - Intergenic
1027224679 7:76236464-76236486 GTCTGGCCCCATGTGGCTCCAGG - Intronic
1029169564 7:98621039-98621061 AGGGGGCCCAAAGTGGGTCCTGG + Intronic
1035282154 7:157785199-157785221 GCGTGTCCCCACGTGGGCCCGGG - Intronic
1040452649 8:47563467-47563489 AAGAGGGCCCATGTGGGGCCAGG - Intronic
1040562895 8:48540416-48540438 TCTTTGCCCCATGTGGTTCCTGG + Intergenic
1040955027 8:52970789-52970811 AGGTGGCCCCATGTGGCTGGAGG + Intergenic
1045327046 8:101125049-101125071 AGGTTGCCCCATCTCGGTCCAGG - Intergenic
1049519195 8:143079668-143079690 GCTCGGCCCCATGTAGGTCCTGG - Intergenic
1052076653 9:24150596-24150618 CCGTGGACCCATCTGGGTCGGGG + Intergenic
1053430005 9:38035865-38035887 AAGTGGCCCAAGGTGGGGCCTGG + Intronic
1054577884 9:66880239-66880261 AAGTTGCCCCATTTGTGTCCGGG - Intronic
1187202926 X:17153518-17153540 ACTTGGCTCAATGTGGGGCCAGG + Intergenic
1189194493 X:39141168-39141190 GCCTGGTCCCATATGGGTCCTGG - Intergenic
1194264987 X:91742972-91742994 ATCTGGACCCATGTGGGACCTGG - Intergenic
1195199998 X:102539478-102539500 CCAAGGCCCCATGTGGATCCAGG + Intergenic
1200582137 Y:4963418-4963440 ATCTGGACCCATGTGGGACCTGG - Intergenic
1201894084 Y:18975233-18975255 ACTTGGCTACAGGTGGGTCCAGG + Intergenic