ID: 971254763

View in Genome Browser
Species Human (GRCh38)
Location 4:25004193-25004215
Sequence GTGGTAGCCCAGCTCTTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971254763_971254767 6 Left 971254763 4:25004193-25004215 CCACCGAAGAGCTGGGCTACCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 971254767 4:25004222-25004244 GACCTGATCATCGATGAGAATGG 0: 1
1: 0
2: 0
3: 4
4: 75
971254763_971254769 24 Left 971254763 4:25004193-25004215 CCACCGAAGAGCTGGGCTACCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 971254769 4:25004240-25004262 AATGGCCTTACAGCCCACGATGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971254763 Original CRISPR GTGGTAGCCCAGCTCTTCGG TGG (reversed) Exonic
907652635 1:56310387-56310409 GGGGTAGCCCTGCTCTGCAGGGG - Intergenic
914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG + Intergenic
915439497 1:155936048-155936070 GTGGTAGCCCATGTCTTGCGGGG - Intergenic
1062976081 10:1683975-1683997 GTGGGATCCCGGCTCTTTGGCGG - Intronic
1064341186 10:14487094-14487116 TGGGTAGCCCTGCTCTGCGGGGG - Intergenic
1065906772 10:30261864-30261886 CTGTAAGCCCAGCACTTCGGAGG + Intergenic
1070452890 10:76579659-76579681 GTGGTGGCCCAGCTGTCCTGAGG - Intergenic
1074717925 10:116236737-116236759 GTTGTACCCCAGCTTTTGGGGGG - Intronic
1076816302 10:132916605-132916627 GTGCTGGCTCAGGTCTTCGGGGG + Exonic
1077296545 11:1829095-1829117 GTGGAAGCTCAGCTCCTCAGAGG + Intronic
1077303060 11:1855979-1856001 GTTGGAGCCCAGCTCTGCAGGGG + Intronic
1082870771 11:57942535-57942557 GTTGTAGCCCAGTGCTTTGGTGG + Intergenic
1084161218 11:67351376-67351398 GAGGTCGCTCAGCTCTTCCGAGG + Intronic
1085746731 11:79121526-79121548 GGAGTAGCCCAGCTCTTCCCTGG + Intronic
1089307326 11:117534867-117534889 CTGGCATCCCAGCTCTTTGGAGG - Intronic
1090027752 11:123182262-123182284 GTGGTTGGCCAGCTCTTCGCAGG - Intronic
1091099430 11:132856742-132856764 GTGGCATGCCAGCACTTCGGAGG - Intronic
1091212470 11:133873931-133873953 GTGGCACCACAGCTCTTCTGTGG + Intergenic
1091396647 12:157424-157446 GGGGTATCCCAGCTCTCCGAAGG - Intronic
1098360421 12:69649114-69649136 GTGTAATCCCAGCTCTTGGGAGG - Intronic
1103972975 12:124683584-124683606 TGGGTAGCTCAGCTCTGCGGAGG - Intergenic
1106785774 13:33106851-33106873 GAGGAAGCCCAGCTCCTGGGTGG - Exonic
1108757280 13:53518969-53518991 GTCCTAGCACAGCTCTTTGGAGG + Intergenic
1113592140 13:111508444-111508466 GGGGTAGCCCAGCTCCGCGGGGG - Intergenic
1134676232 16:16092398-16092420 GTGGTTGCCTAGGGCTTCGGAGG - Intronic
1135791732 16:25402614-25402636 GTGGCAGCCCAGGTCTTCAAGGG + Intergenic
1135933734 16:26761503-26761525 ATGGGATCCCAGCACTTCGGAGG + Intergenic
1137555682 16:49468962-49468984 CTGGCAGCCCAACTCTTCAGAGG + Intergenic
1138556761 16:57775401-57775423 GTGGTTGGCCAGCTCTACTGGGG + Intronic
1139997276 16:70992762-70992784 GTGGCAGCACAGCTCATTGGTGG - Intronic
1141964821 16:87434732-87434754 CTGGTATCCCAGCACTTTGGGGG + Intronic
1142129974 16:88427991-88428013 GTGGAAGCCAAGCTCTTCGGCGG - Exonic
1143448822 17:7023733-7023755 GAGGTTGCCCAGCACGTCGGAGG - Exonic
1143895709 17:10134762-10134784 GGGGTAGCCCTGCTCTGCAGCGG - Intronic
1144734419 17:17547001-17547023 TGGGCAGCCCAGCTCTTCGGGGG - Intronic
1148185458 17:45640221-45640243 GTGGTTGCCCAGTGCTGCGGAGG - Intergenic
1152394406 17:80023686-80023708 GGGGTGGCCCTGCTCCTCGGTGG + Intronic
1155951576 18:31919408-31919430 GTGCAATCCCAGCTATTCGGGGG + Intronic
1156069554 18:33189889-33189911 GTGGTAGCCCTAATCTTGGGTGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160710860 19:550424-550446 GTGGTTGCCCAGCTCTGTGCAGG - Intergenic
1165278604 19:34776772-34776794 GGGGTAGCCCTGCTCTGCAGAGG - Intergenic
1165367358 19:35376462-35376484 GGGGTAGCCCTGCTCTGCAGGGG + Intergenic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
927960975 2:27240577-27240599 GTGGGATCCCAGCTCCTGGGCGG - Intronic
928270259 2:29849162-29849184 GGGGAAGCCCAGCTTTTCTGAGG - Intronic
935671699 2:105561778-105561800 GTGGAGGCCCAGCTCTCCAGAGG + Intergenic
946644795 2:221821567-221821589 GTGGGAACCCAGCTCTTGAGCGG + Intergenic
947654169 2:231812048-231812070 GAGGCAGCCCAGCTCTTCTTGGG + Intergenic
1169116965 20:3072162-3072184 CTGGCAGCGCAGCGCTTCGGCGG - Exonic
1171331230 20:24340358-24340380 GTGGAAGCCCAGGACTTGGGTGG - Intergenic
1172827949 20:37806234-37806256 GGGGTAGCCCAGCTCCTAGGTGG + Intronic
1174833423 20:53834663-53834685 CTGTAATCCCAGCTCTTCGGAGG - Intergenic
1179254851 21:39706754-39706776 GTGGTCTCCCAGCCCTTGGGAGG + Intergenic
1182927038 22:34134726-34134748 GTGGTGGCCCAGCTCCTAAGTGG + Intergenic
1183355998 22:37359849-37359871 GGGGTAGCCCTGCTCTGCAGGGG - Intergenic
957682960 3:83461537-83461559 GTAGTAGCACAGCTGTTTGGGGG - Intergenic
960617540 3:119609534-119609556 ATGGTGGGACAGCTCTTCGGAGG + Exonic
968490200 4:886021-886043 GTGTAATCCCAGCACTTCGGGGG - Intronic
971254763 4:25004193-25004215 GTGGTAGCCCAGCTCTTCGGTGG - Exonic
971280194 4:25236651-25236673 CTGGTAGCTCAGGTCTTCAGAGG + Intronic
984886919 4:184457332-184457354 GTGTTCGCCCAGCCCTTCTGTGG + Intronic
985532099 5:439817-439839 GGGGTGGCCCAGGTCTTTGGGGG + Intergenic
990468419 5:56090790-56090812 GTGGCAGCCCACCTCTCTGGGGG + Intergenic
990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG + Intronic
1003302999 6:4901935-4901957 GTGGCAGCCCAGAGCTGCGGGGG - Intronic
1003466882 6:6389144-6389166 GTGGTAGCCCAGCTCTGGGCTGG - Intergenic
1006366774 6:33620959-33620981 GGGGGAGTCCAGCTCTCCGGCGG - Exonic
1007377672 6:41467763-41467785 GTCGGAGCCCAGCTCTAGGGAGG + Intergenic
1013738577 6:113256973-113256995 CTGGTAAACCAGCTCTTTGGGGG - Intergenic
1019587833 7:1814544-1814566 GTGGTTGCCCAGCTCTGGCGGGG + Intergenic
1023034127 7:36116010-36116032 GTGGTTCCCCAGCTCTGGGGAGG - Intergenic
1023820601 7:43978571-43978593 GCGGCAGCCCAGCTCTTAAGGGG - Intergenic
1028241309 7:88424385-88424407 GTGGTTGCCTAGCTCTTGTGGGG - Intergenic
1029748879 7:102532014-102532036 GCGGCAGCCCAGCTCTTAAGGGG - Intergenic
1029766822 7:102631120-102631142 GCGGCAGCCCAGCTCTTAAGGGG - Intronic
1037823851 8:22148902-22148924 GTCGTGGCCCAGCTGTTTGGCGG - Exonic
1039556245 8:38477338-38477360 CTGTTATCCCAGCTCTTTGGAGG - Intergenic
1046135265 8:110018283-110018305 GTGGTATCTAAGTTCTTCGGTGG + Intergenic
1047740771 8:127804660-127804682 GTGGCATCCCAGCTACTCGGAGG - Intergenic
1058163219 9:101593003-101593025 GTCCTAGCCCTGCTCTTCTGAGG + Exonic
1060731220 9:126038239-126038261 CTGTAATCCCAGCTCTTCGGGGG + Intergenic
1062478949 9:136742686-136742708 CTGGTAGCCCTGCTCCTGGGCGG + Intronic
1185461768 X:336043-336065 CTGGAAGCCCAGCTACTCGGGGG + Intronic
1195267902 X:103201302-103201324 GAGGTAGCCCTGCTCTGCTGGGG + Intergenic
1197784525 X:130187010-130187032 GTGGGAGCCCAGCCCTTTGGGGG - Intergenic
1199798530 X:151227126-151227148 GTGGGAGCCCAGGTCTGCTGGGG + Intergenic
1200169999 X:154065521-154065543 GTGGTGGCCCAGCACTTTGGGGG + Intronic
1202167474 Y:22005699-22005721 AAGGCAGCCCAGCTCTTCAGAGG - Intergenic
1202223886 Y:22580670-22580692 AAGGCAGCCCAGCTCTTCAGAGG + Intergenic
1202319229 Y:23614991-23615013 AAGGCAGCCCAGCTCTTCAGAGG - Intergenic
1202551540 Y:26055066-26055088 AAGGCAGCCCAGCTCTTCAGAGG + Intergenic