ID: 971255153

View in Genome Browser
Species Human (GRCh38)
Location 4:25007818-25007840
Sequence CATGGTCACCAGGCCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971255149_971255153 -8 Left 971255149 4:25007803-25007825 CCATCCCTTTGGCAACATGGTCA 0: 1
1: 0
2: 0
3: 19
4: 156
Right 971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
971255144_971255153 17 Left 971255144 4:25007778-25007800 CCCTGGTGCACATGGACAGCTGG 0: 1
1: 0
2: 3
3: 7
4: 212
Right 971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
971255146_971255153 16 Left 971255146 4:25007779-25007801 CCTGGTGCACATGGACAGCTGGA 0: 1
1: 0
2: 0
3: 22
4: 195
Right 971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
971255143_971255153 18 Left 971255143 4:25007777-25007799 CCCCTGGTGCACATGGACAGCTG 0: 1
1: 0
2: 2
3: 18
4: 151
Right 971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971255153 Original CRISPR CATGGTCACCAGGCCTGCAA AGG Intronic
900515827 1:3081789-3081811 CATGGGCAGCAGGGCAGCAAGGG + Intronic
900793165 1:4692560-4692582 CATGGTCAGGAGGCCTGCGGAGG - Intronic
900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG + Intergenic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901310246 1:8263868-8263890 CAAGGTCACCAAGCCTGGAAGGG + Intergenic
901514071 1:9733533-9733555 CATGGTGTCCACGCCTGCAGGGG + Exonic
903632758 1:24788949-24788971 CATCCTCACCATGCCAGCAAAGG + Intronic
905276710 1:36823104-36823126 CATGGTCACCAGGAGTGAAGGGG + Intronic
905336551 1:37248475-37248497 GAGGGTCCCCAGGCCTCCAAAGG + Intergenic
911095301 1:94049973-94049995 CACTGTCACCAGGCATCCAAGGG + Intronic
912714674 1:111974571-111974593 CATGGACAAGAGCCCTGCAATGG + Intronic
915563624 1:156701755-156701777 CAGGGTCACCCAGCCTGTAAGGG - Intronic
920540532 1:206774532-206774554 CATGGGCACCAGGCAGGCCAGGG + Intergenic
920689690 1:208136485-208136507 CATGGACACCGGGCCAGAAAGGG - Intronic
921070974 1:211657097-211657119 CATGGCCACCAGACATGCCATGG - Intergenic
923172690 1:231431397-231431419 CTAGGTCTCCAGGCCTGTAATGG + Intergenic
923233032 1:232006835-232006857 CTAGGTCTCCAGGCCTGTAATGG - Intronic
923397853 1:233584593-233584615 CCCTGTCACAAGGCCTGCAAAGG + Intergenic
924470210 1:244336674-244336696 GCTGGTCACCAGGCCTCCCAGGG - Intergenic
1062842532 10:682081-682103 CATGGTCAGCAGACCAGCAAAGG - Intronic
1068444010 10:57096356-57096378 CCTGGACACCAAGCCTGCCAAGG - Intergenic
1071411962 10:85405988-85406010 CATGGTGGCGAGGCCTGCATTGG - Intergenic
1076803159 10:132841886-132841908 CATGGCCTCCAGGCTTGCAATGG + Intronic
1077240510 11:1508130-1508152 CATGGCCACCTGGCCTGCAGGGG + Intergenic
1078485589 11:11720284-11720306 CAAGGTCACCATACCTGAAAGGG + Intergenic
1079153362 11:17921867-17921889 GATGGTCATGAGACCTGCAATGG + Intronic
1079976217 11:27094624-27094646 CACGCTCTCCAGACCTGCAAGGG + Intronic
1080577764 11:33615552-33615574 CTTGCACACCAGGCCTGCATTGG + Intronic
1080764248 11:35280938-35280960 CATGGTGACCAGCCCGGCACTGG + Exonic
1081996699 11:47370011-47370033 CATGGTCACCCGGATAGCAATGG + Intronic
1082067758 11:47914763-47914785 CATGGGCTCCAGGCCTGGCATGG - Intergenic
1083843402 11:65317068-65317090 CATGGCCCCCAGGCCTGGCATGG + Intronic
1084949004 11:72654478-72654500 CAAGGTGACCAGGCCTGCTCAGG + Intronic
1085016696 11:73178521-73178543 GAGGGTCCCCAGGCCTGCATAGG - Intergenic
1085749196 11:79145589-79145611 CATGGCCATCAGCCCTGGAATGG - Intronic
1086871065 11:92037214-92037236 CATGGTCTCCAGACCTGCTCAGG + Intergenic
1088038817 11:105351195-105351217 CTAGGCCTCCAGGCCTGCAATGG + Intergenic
1090154605 11:124424457-124424479 CATGGTCACCATGTCCCCAAGGG - Exonic
1092262247 12:6959028-6959050 CGTGGACCCCAGGCCTGCGACGG + Intronic
1093682863 12:22023389-22023411 CTTGGCCTCCAGGCCTGCAATGG - Intergenic
1094664193 12:32502102-32502124 CATGGTAACCAGCCCTCCTAAGG - Intronic
1095755626 12:45763433-45763455 CATTGTCACCTGGGCTGGAATGG - Intronic
1097758012 12:63427844-63427866 CTTGGTTTCCAGGCCTGCAGTGG + Intergenic
1099525881 12:83719129-83719151 CTAGGCCTCCAGGCCTGCAATGG - Intergenic
1100876844 12:98971098-98971120 CAAGGTCACCCAGCCAGCAAGGG - Intronic
1101612517 12:106303973-106303995 CATGGTCACCAGCCCAGTCAGGG + Intronic
1102454762 12:113064606-113064628 CATGGTCACACAGCCAGCAAGGG - Intronic
1102817710 12:115881163-115881185 CAAGGTCACCCAGCTTGCAAGGG - Intergenic
1106938601 13:34751258-34751280 CATGGTTACAATGCCTGCACTGG + Intergenic
1109346988 13:61126091-61126113 CAGGGCCTCCAGGCCTGCGATGG + Intergenic
1110764524 13:79267659-79267681 CATGGCCTCCAGGCCTGGACTGG - Intergenic
1112926271 13:104678941-104678963 CATGGCCATGAGACCTGCAATGG - Intergenic
1113421494 13:110174648-110174670 CAGGGTCCCCAGGCCTTAAAGGG - Exonic
1117771235 14:59136332-59136354 CTTGGTCACCTGGCCTGGAGGGG + Intergenic
1118611919 14:67547955-67547977 CATGGTCACCCAGCCTGCCTGGG + Intronic
1120969623 14:90196514-90196536 CAGGGTCAGCAGACCTTCAAGGG + Intergenic
1121235843 14:92390734-92390756 CACGGGCACCAGGCCTACCAGGG + Intronic
1121795397 14:96730614-96730636 TATGATCACCAGGCAAGCAAGGG + Intergenic
1122133274 14:99618478-99618500 CATGGTTGCCAGGCCTGGCAGGG + Intergenic
1122400899 14:101466793-101466815 GAGGGTCCCCAGGACTGCAAGGG - Intergenic
1122885200 14:104707652-104707674 CATGGCCCCCAGGCCTGGCAGGG - Exonic
1123945772 15:25238220-25238242 CATGGGCACCAAGCCCGCAACGG - Intergenic
1128916368 15:71566662-71566684 CTTGCTCACTAGGCCTTCAAAGG + Intronic
1129716838 15:77857232-77857254 CCTGGGAGCCAGGCCTGCAAGGG - Intergenic
1129788301 15:78323470-78323492 GATGGCCAACAGCCCTGCAACGG - Intergenic
1132467773 16:85437-85459 CATGGTCTCCAGACCTTCCAGGG - Exonic
1135843217 16:25895198-25895220 CATGGTAACCATGCCTACAAAGG + Intronic
1135982812 16:27161601-27161623 CATGACCACCATCCCTGCAAGGG + Intergenic
1136428795 16:30185480-30185502 GACGGTCACCAGGCCTTCCAGGG + Intronic
1137755211 16:50895985-50896007 CAAGGTCAGAAGGGCTGCAATGG + Intergenic
1140610529 16:76593125-76593147 CATGGTCTCCAAGCAAGCAAGGG - Intronic
1140893494 16:79305325-79305347 CAGGGGCACCAGGACTGCAGAGG + Intergenic
1141317786 16:82978424-82978446 CAAGGCCTCCAGGCCTGCAATGG - Intronic
1141414608 16:83860694-83860716 GCTGGTCACCAGGCCTGCCCAGG + Intergenic
1141482506 16:84315938-84315960 CAGGGCCACCAGGCCTTTAAGGG + Intronic
1142233224 16:88909509-88909531 CATGGTCACCCGGGTTGCAGTGG - Intronic
1142523765 17:523276-523298 CATGGTCACCAAGCAGACAACGG + Intronic
1143485991 17:7254574-7254596 CATGGTAAACCAGCCTGCAAAGG - Exonic
1146543656 17:33719283-33719305 CTTGGTGACCAGGAGTGCAAGGG + Intronic
1149965241 17:61156046-61156068 CAAGCTCACCAGGCATTCAAAGG + Intronic
1152018201 17:77765791-77765813 CATGGTCTCCAGGGCTGAAGTGG - Intergenic
1159083393 18:63760586-63760608 CTGGGTCTCCAGGCCTGCAATGG - Intronic
1159816541 18:73080630-73080652 CAGGGTCTCTAGGCCTGCAAAGG + Intergenic
1160102376 18:75935004-75935026 CAGGGTCAGAAGGCCTGCAGAGG + Intergenic
1160403483 18:78628678-78628700 CAGGGTCACCAGGCCTGAGATGG - Intergenic
1160830775 19:1104145-1104167 AACGGTCACCGGGCCGGCAACGG - Intronic
1161503794 19:4633127-4633149 TATGGGCACCATGCATGCAAAGG + Intergenic
1161778734 19:6278198-6278220 CAGGGGCACCAGGCCAGGAAAGG - Intronic
1161784087 19:6312277-6312299 CATGGAGAACAGGCCTGCAGCGG + Exonic
1161963938 19:7537600-7537622 CATGATCAATAGTCCTGCAATGG + Intronic
1162337541 19:10071107-10071129 CATGGGGATGAGGCCTGCAAAGG + Intergenic
1162362413 19:10227918-10227940 CGTGCTCCCCAGGCCTGGAAAGG - Intronic
1162461900 19:10818382-10818404 CATGGGCACCAGCTCTGCAGTGG + Intronic
1164070012 19:21758932-21758954 CATGGAGACCTGGCCTGGAATGG - Intronic
1167398986 19:49252416-49252438 CAGGTTGACCAGGGCTGCAATGG + Intergenic
925478269 2:4243423-4243445 CAGGGTCACCAGACCTGCAGTGG - Intergenic
925970870 2:9105754-9105776 CCAGGTCACCAGGCCGGTAAGGG - Intergenic
926363483 2:12112076-12112098 CATTGACACCAGGACTGCTAGGG + Intergenic
929158024 2:38805263-38805285 CATGTTCACAAAGCCTGGAAAGG - Intronic
930503746 2:52255957-52255979 CTGGGCCTCCAGGCCTGCAATGG + Intergenic
931100883 2:58999675-58999697 CATGGGAACCAGGACTGCTATGG - Intergenic
932006547 2:67933325-67933347 CTGGGCCTCCAGGCCTGCAATGG - Intergenic
933849804 2:86356809-86356831 CAGGGTCACCCAGCCAGCAATGG + Intergenic
936788827 2:116125802-116125824 CTAGGCCTCCAGGCCTGCAATGG + Intergenic
936989434 2:118346838-118346860 CCTAATCACCAGGCCTGCACAGG - Intergenic
938693959 2:133818356-133818378 CATGGTAACCAGGCACGGAAAGG - Intergenic
939016849 2:136913517-136913539 CTGGGCCTCCAGGCCTGCAATGG - Intronic
941639515 2:167972112-167972134 CAGGGTCACTAGGGCTGCTAAGG + Intronic
946167162 2:217871348-217871370 AATGGTCACCTGGCCTCCAGAGG - Intronic
947220199 2:227784377-227784399 GAGGGTCAGCAGCCCTGCAAAGG - Intergenic
948826547 2:240575861-240575883 CATGGAAACCAGGTGTGCAAAGG + Intronic
948997687 2:241592034-241592056 AATGGTCACCAGACCTGAACAGG + Intronic
1170627001 20:18037618-18037640 GATGCTCTCCAGGCCTGCAAAGG + Intronic
1170775747 20:19373318-19373340 CATGGTCACCTCCTCTGCAAAGG + Intronic
1171121944 20:22576181-22576203 CATGGCAACCAGGCCAGCCAGGG - Intergenic
1172571393 20:35973697-35973719 CCTGGTCACCAGGCCAGGCACGG - Intronic
1172940145 20:38648548-38648570 CATGGCCCCCAGCCCTGGAAAGG - Intronic
1174267649 20:49343578-49343600 GATGGCCACGAGGCCAGCAAGGG + Intergenic
1176689089 21:9882079-9882101 CTAGGTCACCAGGCCTGTGATGG + Intergenic
1177604988 21:23366886-23366908 CTTTGTCACAAGTCCTGCAAGGG - Intergenic
1179197077 21:39174249-39174271 CAAAGTCACCTGGCCTGTAAGGG + Intergenic
1180630977 22:17229787-17229809 CATGGTCTCCAGGCCAGATAAGG - Intergenic
1181112369 22:20609629-20609651 CCTGGTCACCTGTCCTGCCATGG + Intergenic
1182045936 22:27274099-27274121 CACAGCCACCAGGCCTGCAAAGG + Intergenic
1184206575 22:43007816-43007838 CAGGGGCACCAGGCATGCAGTGG + Intronic
1184474867 22:44714889-44714911 CAGGGCCACCAGGCCTGAAGTGG - Intronic
1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG + Intronic
950193813 3:10995109-10995131 CAAGGTCACCTGGCCAGAAATGG - Intronic
954269923 3:49499794-49499816 CAAGGACACCAGGCATCCAAGGG - Intronic
954424998 3:50438527-50438549 CAAGGTCACCATTCCTGCAAGGG - Intronic
954590985 3:51781393-51781415 CATGGCAACCTGGCCTGGAAGGG - Intergenic
956197218 3:66665065-66665087 CATGGTCACCTTAGCTGCAAAGG - Intergenic
956841266 3:73142329-73142351 GATGGTCACCAGAACTGCATGGG + Intergenic
959149425 3:102591046-102591068 CTAGATCTCCAGGCCTGCAATGG - Intergenic
959808962 3:110593489-110593511 CTTGGTCTCCAGGACTGTAATGG - Intergenic
960225830 3:115167451-115167473 CATGGTCACTGGACCTGCACTGG - Intergenic
961639335 3:128355135-128355157 CCTGTTCACCAGGCCTGTAGTGG + Intronic
963355631 3:144206615-144206637 CATGGTCTCCACTCCTGCCATGG - Intergenic
964867220 3:161275246-161275268 CATGGTCTTGAGGCCTGCAGGGG + Intergenic
971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG + Intronic
972704118 4:41524465-41524487 CGTACTCACCAGTCCTGCAATGG - Exonic
972775779 4:42239141-42239163 CATGAGCACCAGAGCTGCAAGGG - Intergenic
976051074 4:81012212-81012234 CTTGGTCTCCAGGCCTGTGATGG - Intergenic
980352471 4:131699896-131699918 CTAGGTCACCAGGCCTGTGATGG + Intergenic
981022451 4:140042963-140042985 CATGGTCACTGAGCCTGTAAGGG - Intronic
982880557 4:160709408-160709430 CCTGGCCATCAGACCTGCAATGG - Intergenic
984502503 4:180574016-180574038 CATGGCCACCAAGGCTGCGATGG + Intergenic
987924419 5:24321466-24321488 TTAGGTCACCAGGCCTTCAAAGG + Intergenic
992337705 5:75790032-75790054 CATTATCACCAGCCCTTCAAAGG + Intergenic
993967225 5:94372660-94372682 CTGGGTCTCCAGGCCTGTAATGG + Intronic
996727929 5:126688752-126688774 CCAGGTCACCTGGCCTGCAGTGG - Intergenic
997022089 5:130013721-130013743 CCAGGCCTCCAGGCCTGCAATGG + Intronic
998152119 5:139763512-139763534 CATGGTCATCATCCCAGCAAGGG - Intergenic
998168705 5:139859504-139859526 CCTGGACACCAGCCCTTCAAGGG + Intronic
999303382 5:150504665-150504687 CAAGGTCACCAGGCCAGGAAGGG - Intronic
999341725 5:150778893-150778915 CAGGGTCCCCAGGACTGCACGGG - Exonic
1001686666 5:173598675-173598697 CATGGTCCCCGGGCCCGGAATGG - Intergenic
1002534118 5:179866777-179866799 CACTGTCACCAGGACTGCCATGG + Intronic
1003477276 6:6495079-6495101 CATGGACAGGAGGACTGCAAAGG + Intergenic
1003638379 6:7855495-7855517 CATGGTCACACAGCCAGCAAGGG - Intronic
1003690156 6:8346205-8346227 CTAGGTCACCAGGCCTATAATGG - Intergenic
1005852104 6:29829560-29829582 CGTGGAGACCAGGCCTGCAGGGG + Exonic
1005859474 6:29889471-29889493 CGTGGAGACCAGGCCTGCAGGGG + Intergenic
1005867038 6:29944264-29944286 CGTGGAGACCAGGCCTGCAGGGG + Exonic
1005932039 6:30491279-30491301 CGTGGAGACCAGGCCTGCAGGGG + Exonic
1016939066 6:149469774-149469796 CCTGGGCACCAGCCCTGCAGAGG + Intronic
1017022666 6:150152775-150152797 GAGAGTCACCAGGGCTGCAAAGG - Intronic
1017203030 6:151776173-151776195 TATGTTCTCCAGGCCTCCAATGG - Intronic
1018721532 6:166576884-166576906 CTAGGCCTCCAGGCCTGCAATGG - Intronic
1021704127 7:23350156-23350178 CATAGGCACCATGCCTGCATTGG - Intronic
1023276325 7:38522576-38522598 CTTGGTCAGCAGGCCTCCAGAGG + Intronic
1023520640 7:41046855-41046877 CAGGGTCACCATGGCTGCAAAGG + Intergenic
1023560660 7:41470251-41470273 CAGAGTCTCCAGGCCTGCCAGGG - Intergenic
1024945426 7:54803172-54803194 CATGGTAACCAGTCATGGAAAGG + Intergenic
1031230215 7:119096107-119096129 CTTGGCCTCCAGGCCTGTAACGG + Intergenic
1035293778 7:157856066-157856088 CCTGCTCACCAGCTCTGCAAAGG + Intronic
1038455811 8:27671239-27671261 CAGGGTCACCAGGCCAGCGGGGG + Exonic
1039345896 8:36704878-36704900 CATGGCAACCAGCCCTGCAATGG + Intergenic
1041740669 8:61153399-61153421 CATTTTCACAAGGCCTCCAAAGG - Intronic
1043458155 8:80432481-80432503 CAGGGTCACCAGGGCTGCTCAGG - Intergenic
1044136163 8:88588748-88588770 CAGGGTCACCAAGCAGGCAAGGG + Intergenic
1046257713 8:111722388-111722410 CAAGGTCTCCAGGCCTGTGATGG + Intergenic
1049195820 8:141315144-141315166 CAAGGTCACAGGGCCTGCCAGGG + Intergenic
1049239280 8:141528766-141528788 CTTGGGCTCCAGGCCTGCCAGGG - Intergenic
1049860567 8:144895445-144895467 CATGATCTCCAGGCCTTCAGAGG - Intronic
1050017071 9:1245320-1245342 CATGGTCACCCCATCTGCAAGGG - Intergenic
1050335110 9:4583079-4583101 CATGGTCACCAGGCCAGCCTGGG - Exonic
1053780238 9:41599817-41599839 CTAGGTCACCAGGCCTGTGATGG - Intergenic
1054168180 9:61809974-61809996 CTAGGTCACCAGGCCTGTGATGG - Intergenic
1054669348 9:67770844-67770866 CTAGGTCACCAGGCCTGTGATGG + Intergenic
1056253966 9:84779224-84779246 CAATGTCACCAGGCTTCCAATGG - Intronic
1058590485 9:106559695-106559717 CATGATGACCAGTCCTTCAATGG - Intergenic
1060527232 9:124327476-124327498 CATGGTCACCAGGACCGCTGGGG - Intronic
1061536713 9:131254850-131254872 CAGGGTCAACAGGGCTGCTAAGG + Intergenic
1062432872 9:136533721-136533743 CATGGTCACCGAGCCTGCCCGGG - Intronic
1062707780 9:137954688-137954710 CAAGGTGACCAGGCCTGCCCAGG - Intronic
1186043424 X:5506891-5506913 CACGGTCACCAGAACAGCAAGGG + Intergenic
1187183250 X:16963625-16963647 CATGTTGACCTGACCTGCAAAGG - Intronic
1195293634 X:103453885-103453907 CATGGTAACCAGGCTAGCCAAGG - Intergenic
1197536137 X:127691230-127691252 CTAGGTCTCCAGGCCTGTAATGG - Intergenic
1199055777 X:143292740-143292762 CATGGTGACCACGCCTGTAAGGG + Intergenic
1199811442 X:151353764-151353786 CAAGGTCACACGGCCAGCAAAGG - Intergenic
1200064523 X:153498057-153498079 CACCTTCACCAGGCCTGCCAGGG - Intronic
1201368349 Y:13234127-13234149 CATGGATCCCAGGCCTGCCAAGG + Intergenic
1201785417 Y:17771743-17771765 CATGGACACAAGGCCTGACAAGG + Intergenic
1201816136 Y:18134244-18134266 CATGGACACAAGGCCTGACAAGG - Intergenic