ID: 971255703

View in Genome Browser
Species Human (GRCh38)
Location 4:25011502-25011524
Sequence CTGGGAAGCCACTTGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 433}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971255694_971255703 -4 Left 971255694 4:25011483-25011505 CCCCACATCCCTGTACCTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 262
Right 971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 433
971255693_971255703 -1 Left 971255693 4:25011480-25011502 CCTCCCCACATCCCTGTACCTGC 0: 1
1: 0
2: 1
3: 37
4: 458
Right 971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 433
971255698_971255703 -6 Left 971255698 4:25011485-25011507 CCACATCCCTGTACCTGCTGGGA 0: 1
1: 0
2: 1
3: 25
4: 282
Right 971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 433
971255691_971255703 4 Left 971255691 4:25011475-25011497 CCCTGCCTCCCCACATCCCTGTA 0: 1
1: 0
2: 9
3: 86
4: 590
Right 971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 433
971255696_971255703 -5 Left 971255696 4:25011484-25011506 CCCACATCCCTGTACCTGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 433
971255692_971255703 3 Left 971255692 4:25011476-25011498 CCTGCCTCCCCACATCCCTGTAC 0: 1
1: 0
2: 2
3: 56
4: 568
Right 971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971255703 Original CRISPR CTGGGAAGCCACTTGGTGCT TGG Intronic
900469664 1:2847482-2847504 CTGGAAACTCCCTTGGTGCTGGG + Intergenic
900950726 1:5857022-5857044 CTGGGAAACCCCTTGCTGGTGGG - Intergenic
901650430 1:10739857-10739879 CTGGGAAGCCGCAAGGTGCTGGG + Intronic
901679775 1:10906287-10906309 CTGGGCACCCACTTGGTGCCAGG - Intergenic
901884996 1:12216539-12216561 CAGGGAATTGACTTGGTGCTGGG + Intergenic
902612957 1:17607949-17607971 CTGGAAGGACACTCGGTGCTTGG - Exonic
902648145 1:17818436-17818458 GTGGGAGGCCACTGGGGGCTTGG - Intronic
902878139 1:19353189-19353211 CTGGGATGGCTCTTGGGGCTAGG + Intronic
903018524 1:20377570-20377592 CTGGGAAGCTACTTGAGGCAGGG + Intergenic
904744356 1:32702207-32702229 TGTGGAAGCCACTTGGTGCAAGG - Intronic
906396471 1:45470740-45470762 TTGGGTAGCCACTAGGTGCAAGG + Intronic
907779430 1:57552287-57552309 CTCAGCACCCACTTGGTGCTAGG + Intronic
911191591 1:94953990-94954012 CTGAGCAGCCACGTGGTGCAAGG - Intergenic
911412868 1:97532489-97532511 CTGTGAAGCCACCTGGTCGTAGG + Intronic
912607921 1:111011520-111011542 CTGGGAAACCATCTGGTCCTGGG - Intergenic
912761549 1:112371701-112371723 TTGGGAAGCCACTTGAGCCTAGG + Intergenic
914309958 1:146457921-146457943 CTGTGAGGCCATTTGGTCCTGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915005598 1:152632430-152632452 CTGTGAATCCACCTGGTCCTGGG - Intergenic
916616037 1:166441150-166441172 CAGTGAAGCCACTGGGTCCTGGG + Intergenic
916652660 1:166845822-166845844 CTGAGGAGCCCCCTGGTGCTGGG + Intronic
916774553 1:167946983-167947005 CTGTGAAGCCATCTGGTACTGGG + Intronic
917266945 1:173230975-173230997 CTGTGAATCCATCTGGTGCTGGG - Intergenic
917681226 1:177369976-177369998 CTGTGAATCCACTGGGTCCTAGG + Intergenic
918129422 1:181612326-181612348 CTGGGAAGTCAATTTGTGATTGG - Intronic
918239990 1:182612544-182612566 TTGGGAATCCTCTTGGAGCTGGG - Intergenic
919215153 1:194543652-194543674 CTGTGAATCCGCTTGGTTCTGGG + Intergenic
919533780 1:198760586-198760608 CTGTGAATCCACTGGGTCCTGGG + Intergenic
921756526 1:218863016-218863038 CTGTGAGGCCACCTGGAGCTTGG - Intergenic
921823506 1:219644685-219644707 CAGTGAAGCCACTGGGTCCTGGG - Intergenic
922618646 1:226977735-226977757 CTGGGTGGCCACTTTGGGCTGGG - Intronic
922620010 1:226983460-226983482 CTGGGAAGCCAGTTGGGGGTTGG + Intronic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
1063997653 10:11635736-11635758 CAGGGAAGACATTTGGTCCTGGG + Intergenic
1066014883 10:31231377-31231399 CTGTGAATCCATTTGGTCCTGGG - Intergenic
1066142623 10:32522283-32522305 CAGTGAAGCCACTGGGTCCTGGG + Intronic
1066804779 10:39236056-39236078 CTGAGAAACCACTTTGTGATGGG + Intergenic
1067575478 10:47405967-47405989 CTGGGAGGGCACCTGGAGCTCGG - Intergenic
1068910930 10:62377238-62377260 CTTGCACGCCATTTGGTGCTAGG - Intronic
1069889489 10:71644190-71644212 CTGGGGAGCCACTTTGGGCTGGG + Intronic
1070324362 10:75378284-75378306 CTGTGAAGCCAGTTGGGGATGGG - Intergenic
1070742146 10:78910240-78910262 CTGAGAATCCACTAGGTGCCAGG - Intergenic
1070896793 10:79990314-79990336 CAGTGAAGCCACTGGGTCCTAGG - Intergenic
1071059365 10:81551642-81551664 CTGTGAATCCATTTGGTCCTAGG - Intergenic
1071507346 10:86240752-86240774 CTGGAAAGCCACATGTTGTTAGG - Intronic
1071675721 10:87654313-87654335 CTGGGCAGCCTTTTGGTGATAGG + Intergenic
1072027099 10:91470813-91470835 CCGTGAATCCACTTGGTTCTGGG - Intronic
1072111172 10:92321653-92321675 CAGTGAAGCCATTTGGTCCTGGG + Intronic
1072412963 10:95221767-95221789 CTGTGAAGGCATTTGGTGCTGGG - Intronic
1072690072 10:97566913-97566935 CTTGGAGGTCACTTGGAGCTGGG + Intronic
1073070897 10:100792641-100792663 TTGGGAAGCCAGGAGGTGCTAGG + Intronic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073984907 10:109196963-109196985 CTGTGAATCCATTTGGTCCTGGG + Intergenic
1074851495 10:117442949-117442971 ATGTGAAGCCACTTGGTACTAGG + Intergenic
1074979767 10:118610120-118610142 TTGGGAAGCCCCTGGGTGCCAGG - Intergenic
1075295248 10:121269696-121269718 CTGGGAAGCCACCTGGAGCATGG + Intergenic
1075728857 10:124624588-124624610 CTGGGAGCACACTTGGTGCCTGG - Intronic
1076130398 10:128010098-128010120 CTGGGCAGCCCCTGGGTGCCAGG + Intronic
1076333875 10:129692055-129692077 CTGAGCACCCACTGGGTGCTGGG - Intronic
1076883623 10:133251614-133251636 CTGGGGAGCCACAGGGAGCTCGG - Intergenic
1077315629 11:1918260-1918282 CTGGGAAGGCTCTTGGAGCTGGG - Intergenic
1080439993 11:32284157-32284179 CTGTGAATCCATTTGGTCCTGGG - Intergenic
1080670753 11:34374413-34374435 CTGTGAAGCCATCTGGTCCTAGG + Intergenic
1080965838 11:37213401-37213423 CAGTGAAGCCACTGGGTACTAGG + Intergenic
1081034205 11:38121706-38121728 CTGGGAATCTCCATGGTGCTAGG - Intergenic
1081049475 11:38319728-38319750 CAGTGAAGCCATTGGGTGCTTGG - Intergenic
1081413058 11:42782754-42782776 CTGGGACTACATTTGGTGCTGGG - Intergenic
1081758310 11:45560159-45560181 CTGGGAAGGCACTTGGGGGCTGG - Intergenic
1082184155 11:49159740-49159762 CTGTGAATCCATTTGGTCCTTGG + Intronic
1082585752 11:54937507-54937529 CTGGGAAACCACTTTGTGATGGG - Intergenic
1082668314 11:56003383-56003405 CTGGGAATCCATCTGATGCTGGG - Intergenic
1082866017 11:57900838-57900860 TTTGGAAGCCCCTTGGTGCTAGG + Intergenic
1083043740 11:59713388-59713410 CTGGTAGGCTCCTTGGTGCTGGG - Exonic
1084111424 11:67016357-67016379 CTGGGAAGGAGCTTGGAGCTGGG + Intronic
1084312444 11:68324890-68324912 CTGGCACGCCACTGGGTGCTAGG + Intronic
1084501424 11:69537875-69537897 CCGGGCACCCACTGGGTGCTGGG - Intergenic
1084735604 11:71103372-71103394 CTGGGAAGCCTGTTGGTCCCAGG - Intronic
1085439150 11:76542228-76542250 CTGGGAAGGCTGTTGGGGCTGGG - Exonic
1086571045 11:88285001-88285023 CTGGGAAGACACTTGCTGAAAGG + Intergenic
1086682199 11:89685632-89685654 CTGTGAATCCATTTGGTCCTCGG - Intergenic
1088723613 11:112615700-112615722 CTGGGAATCCTCTTAGTCCTAGG + Intergenic
1089144069 11:116311520-116311542 CTGGCACCACACTTGGTGCTAGG - Intergenic
1090954806 11:131504419-131504441 CTGGTAAACCCCTTGGGGCTTGG + Intronic
1091387842 12:105911-105933 TTGGGAAACCTGTTGGTGCTTGG + Intronic
1091635047 12:2190727-2190749 CTGTGAAGCCACCAGCTGCTGGG - Intronic
1091839354 12:3608498-3608520 TTGGGAAACCATATGGTGCTTGG - Intronic
1092393879 12:8107489-8107511 CTGTGAATCCACCTGGTCCTGGG + Intergenic
1092497969 12:9016536-9016558 CAGTGAAGCCACTGGGTCCTGGG - Intergenic
1093400092 12:18735360-18735382 CTGTGAAGTCATTTGGTCCTGGG + Intronic
1094867838 12:34559685-34559707 CTGAGAAACCACTTTGTGATGGG - Intergenic
1095542718 12:43329819-43329841 CTGTGAATCCATTTGGTCCTTGG + Intergenic
1095542969 12:43331812-43331834 CTGTGAATCCATTTGGTCCTGGG + Intergenic
1097749272 12:63334105-63334127 CTGTGAATCCACCTGGTTCTGGG - Intergenic
1097752301 12:63369032-63369054 CTGTGAATCCATTTGGTCCTGGG + Intergenic
1098885154 12:75953478-75953500 CTGGGAACCCAATCAGTGCTGGG - Intergenic
1099010913 12:77290067-77290089 CTGTGAATCCATTTGGTCCTGGG - Intergenic
1099141068 12:78975847-78975869 AGGGGAAGCCACTTTATGCTTGG + Intronic
1101842593 12:108339235-108339257 CTGGGAAGCCTCCGGGTGATAGG - Exonic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1102470533 12:113157570-113157592 CTGGGATGTGACTTCGTGCTGGG + Exonic
1102754810 12:115329729-115329751 CAGTGAAGCCATCTGGTGCTAGG + Intergenic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1104470788 12:129028138-129028160 CTGGGCACCAACTTGGTGCAAGG - Intergenic
1104848326 12:131858276-131858298 CTGGGGAGGCCCTGGGTGCTGGG + Intergenic
1105251087 13:18698607-18698629 CTGGGAAGGCTCAGGGTGCTGGG - Intergenic
1106288743 13:28341315-28341337 CTGAGCAGCTACTAGGTGCTTGG + Intronic
1107899286 13:44996010-44996032 CTGAGTACCCACTTTGTGCTGGG - Intronic
1110665455 13:78112046-78112068 CAGTGAAGCCACTGGGTCCTGGG + Intergenic
1112385697 13:98937921-98937943 GTGGGAAGCCACTTAGCCCTGGG + Intronic
1113887196 13:113667198-113667220 CTGGGAAGCCCCTGGGAGCCCGG - Exonic
1114991157 14:28291876-28291898 CTGTGAATCCATCTGGTGCTAGG + Intergenic
1115242332 14:31261913-31261935 CTGGGCACCCACTGTGTGCTGGG - Intergenic
1115956025 14:38780374-38780396 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
1116154155 14:41182218-41182240 CTGGAAAGCTCCTTGTTGCTAGG + Intergenic
1118143026 14:63105960-63105982 GTGGGAAGGCAATAGGTGCTGGG - Intergenic
1120687238 14:87551793-87551815 CTGTGAAGCCATTTCGTCCTGGG - Intergenic
1121647900 14:95533960-95533982 CTGAGCAGCCGCTGGGTGCTAGG - Intronic
1121708269 14:96017520-96017542 CTGGGAAGCCACATGGAGTCAGG - Intergenic
1122287031 14:100658351-100658373 CTGAGGGGCCACATGGTGCTGGG + Intergenic
1122902109 14:104786259-104786281 CTGGGAACCCACTGGGTGGAGGG - Intronic
1202896290 14_GL000194v1_random:12633-12655 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1124203325 15:27697031-27697053 GTGGGAGGCCTCTTCGTGCTTGG - Intergenic
1124644195 15:31424118-31424140 CAGTGAAGCCACCTGGTCCTGGG - Intronic
1127105112 15:55605451-55605473 CTGTGAAGCCACCTGGTCTTGGG - Intergenic
1127301360 15:57656939-57656961 CTGGAGAGACACTTGGTTCTGGG - Intronic
1127635003 15:60860776-60860798 CTGGGCACCCACTGTGTGCTAGG + Intronic
1128980234 15:72180334-72180356 TTGGCAGGCCACTTGGGGCTTGG + Intronic
1129030498 15:72614567-72614589 CTGCTGAGCCACTTGGAGCTGGG + Intergenic
1129209724 15:74060708-74060730 CTGCTGAGCCACTTGGAGCTGGG - Intergenic
1129477340 15:75795089-75795111 CTGCTGAGCCACTTGGAGCTGGG + Intergenic
1129835396 15:78702349-78702371 CTGCTGAGCCACTTGGAGCTGGG + Intronic
1130511918 15:84596251-84596273 CTGCTGAGCCACTTGGAGCTAGG - Intergenic
1132199450 15:99940028-99940050 CTGTAAAGCCATTTGGTCCTGGG + Intergenic
1132463526 16:67181-67203 TTGGGAAGGCAGGTGGTGCTCGG + Intronic
1132645046 16:995105-995127 CTGGGAAGCCCCTCAGTCCTGGG + Intergenic
1133781285 16:8941155-8941177 CTGGGAAGTAATTTGGTGGTGGG - Intronic
1133923989 16:10179944-10179966 CTGGGAAGCCACCAGCTGCATGG - Intronic
1134732061 16:16471029-16471051 GTAGGAAGCCACCTAGTGCTGGG + Intergenic
1134935380 16:18240934-18240956 GTAGGAAGCCACCTAGTGCTGGG - Intergenic
1135915745 16:26604064-26604086 CTGGGAAGCTGCATGATGCTGGG + Intergenic
1136368533 16:29821240-29821262 CTGGGTAGCCCCTGGGTGATGGG + Intronic
1136603867 16:31318027-31318049 CTGAGAAGCCACCAGGTCCTGGG + Intronic
1136738745 16:32491619-32491641 CTGAGAAACCACTTTGTGATTGG + Intergenic
1136740276 16:32514581-32514603 CTGAGAAACCACTTTGTGATGGG - Intergenic
1138151871 16:54665186-54665208 CTGTGAATCCATCTGGTGCTGGG - Intergenic
1139504677 16:67392977-67392999 CTTGGATGCCACAGGGTGCTTGG + Intronic
1139665320 16:68451052-68451074 CAGGGAAGGCAATTGGAGCTGGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141373578 16:83509110-83509132 ATGGGAAGCCCCTGGGGGCTGGG - Intronic
1141481449 16:84309345-84309367 CTGGGAAGCCTCTGGGGCCTTGG + Intronic
1141494949 16:84402893-84402915 CAGTGAAGCCACTGGGTCCTGGG + Intronic
1141566855 16:84908395-84908417 CTGGGAAACTTCTGGGTGCTGGG + Exonic
1141592311 16:85077186-85077208 CTGAGAAGCCACTAGGAGCAGGG - Intronic
1203014468 16_KI270728v1_random:340172-340194 CTGAGAAACCACTTTGTGATTGG - Intergenic
1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG + Intergenic
1203032803 16_KI270728v1_random:613331-613353 CTGAGAAACCACTTTGTGATTGG - Intergenic
1203042381 16_KI270728v1_random:773771-773793 CTGAGAAACCACTTTGTGATGGG - Intergenic
1142639441 17:1277381-1277403 CTCGGAAGCCACATGTGGCTAGG + Intergenic
1142815260 17:2420177-2420199 CTCAGAAGCCTCTTGGTCCTGGG + Exonic
1143410219 17:6704114-6704136 CTGGGAAGCAACTGGGGACTGGG + Intronic
1143449371 17:7026844-7026866 CTTGGAAGCCACTTGGAGGCTGG - Intronic
1146259447 17:31412046-31412068 CTGGGGAGCAGCTTGGTCCTGGG + Intronic
1149025430 17:52021935-52021957 CTGTGAATCCACCTGGTCCTGGG - Intronic
1149047353 17:52262689-52262711 CTGTGAATCCACCTGGTCCTGGG + Intergenic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1150211318 17:63443187-63443209 CTGGGAAGCCCCTTCTTCCTGGG - Intronic
1150482133 17:65518714-65518736 CTGGGAAGACACTGTGTGTTAGG + Intergenic
1151139615 17:71978909-71978931 ATGGAAAGGTACTTGGTGCTTGG + Intergenic
1151437294 17:74105752-74105774 CTGGGAAGCCACAGGGTGTGGGG - Intergenic
1151966024 17:77432129-77432151 CTGGGAAGCCACATGCTACCTGG + Intronic
1152422741 17:80202886-80202908 CAGGGAAGCCCCTCGGTCCTGGG + Intronic
1152986698 18:327900-327922 CTGTGAAGCCATCTGGTCCTGGG + Intronic
1153504041 18:5777467-5777489 CAGTGAAGCCACCTGGGGCTTGG + Intergenic
1154437761 18:14360307-14360329 CTGGGAAGGCTCAGGGTGCTGGG + Intergenic
1156247250 18:35313201-35313223 CAGTGAAGCCACCTGGTCCTGGG - Intergenic
1156467392 18:37356491-37356513 CTGGGAAGGCCATTGGTGCTGGG + Intronic
1156535290 18:37857898-37857920 CAGTGAAGCCACTGGGTCCTGGG + Intergenic
1156563642 18:38158806-38158828 CTGGGGAGCCTCTTGGAGCTGGG - Intergenic
1157970893 18:52267498-52267520 CTGTGAAGCCATCTGGTCCTAGG + Intergenic
1158131143 18:54153744-54153766 CTGGGAAGCCAATTGGTAGAGGG - Exonic
1158388982 18:57027488-57027510 CTGGGAACGCTCTTGTTGCTTGG + Exonic
1159550513 18:69890821-69890843 CTGTGAAGCCACCTGGTCCTGGG - Intronic
1160589419 18:79934703-79934725 CTGGGAAGCCCCATGGGGTTTGG + Intronic
1160672966 19:374998-375020 CAGGGCAGCCACTTTGTTCTTGG + Intronic
1161084977 19:2330771-2330793 CGTGGAAGGCGCTTGGTGCTGGG + Intronic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1161756174 19:6135854-6135876 CTGGCAAGGCACCTGGAGCTGGG - Exonic
1162687939 19:12403042-12403064 CAGTGAAGCCACTGGGTTCTGGG + Intronic
1162802879 19:13120569-13120591 CTGGCTAGCCACTTGGTTCTAGG + Intronic
1162945630 19:14041721-14041743 CTGGAAACCCCCTTGGTCCTGGG + Intronic
1163479954 19:17549383-17549405 CAGGGAAGCCCCTTGATGCCTGG + Intronic
1163639012 19:18451101-18451123 CTGGGACCTGACTTGGTGCTCGG - Intronic
1164934014 19:32197230-32197252 CTGGGAACCCCCTTAGTCCTGGG - Intergenic
1166263519 19:41660625-41660647 CTGTGAATCCATCTGGTGCTGGG - Intronic
1167349961 19:48968411-48968433 CTGTGAAACCACTAGGTTCTAGG - Exonic
1168403497 19:56099153-56099175 CTGGGAAGCCACTGGGCAGTGGG - Intronic
925734178 2:6945910-6945932 CTGGGGAGCCCCTTGGAGCCTGG + Intronic
927047781 2:19297529-19297551 TTGGGAAGCCAATTGTTTCTAGG - Intergenic
927623848 2:24691574-24691596 CTGGCAAGCTTCTTGGTTCTCGG - Exonic
927712158 2:25332712-25332734 CTGGGAAGCCCAGTGGGGCTGGG - Intronic
927947327 2:27143890-27143912 CAGTGAAGCCATTTGGTTCTGGG + Intergenic
929338237 2:40779313-40779335 CTGTGAAGCCATCTGGTTCTGGG - Intergenic
929571151 2:43023938-43023960 CTGGGAAGCTTCTGGGTGCTGGG + Intergenic
929932842 2:46272213-46272235 CTGAGCAGCCACTTGGTGCTGGG - Intergenic
931552048 2:63457350-63457372 CAGGGAATCCACCTGGTCCTTGG - Intronic
931572658 2:63685484-63685506 CCGTGAAGCCACTGGGTCCTGGG - Intronic
932040148 2:68290938-68290960 CTGGGTAGCCATCTGATGCTTGG + Intronic
933157569 2:78992713-78992735 CAGGGTAGCCTCTTGGGGCTCGG - Intergenic
933339077 2:80998516-80998538 CTGGGTAGCCACTTTCTGTTGGG + Intergenic
933708083 2:85306183-85306205 CTGGGAAGGCACGTGGTTGTAGG - Intronic
934946951 2:98549258-98549280 CCAGGAAGCCCCTGGGTGCTGGG + Intronic
935193766 2:100798843-100798865 CCAGGAAGCCACCTGCTGCTGGG + Intergenic
936560119 2:113530618-113530640 CTGGGAAGCCATCTGGTTTTGGG + Intergenic
937443019 2:121932960-121932982 CAGGGAACCCACTTGGAGCTAGG - Intergenic
937610830 2:123858945-123858967 CTGTGAATCCATTTGGTTCTGGG - Intergenic
937688725 2:124728393-124728415 CAGTGAAGCCACATGATGCTAGG + Intronic
937893626 2:126960229-126960251 CTGTGAATCCATTTGGTCCTGGG + Intergenic
940365337 2:152842647-152842669 CTGTGAAGCCATCTGGTCCTGGG + Intergenic
942350409 2:175046656-175046678 CAGTGAAGCCACTAGGTCCTGGG + Intergenic
942638509 2:178035406-178035428 CTGTGAAGCCATCTGGTCCTGGG - Intronic
942729021 2:179043252-179043274 CTGTGAATCCACCTGGTCCTGGG - Intronic
943276958 2:185879836-185879858 CTGTGAATCCATTTGGTCCTGGG - Intergenic
944291428 2:198010758-198010780 CAGAGAAGCCACATGGTCCTGGG + Intronic
945479874 2:210333017-210333039 CTGTGAATCCACCTGGTTCTGGG + Intergenic
946668027 2:222071552-222071574 TTGAGAACCCACTTGGTGCCAGG - Intergenic
947495738 2:230635168-230635190 CTGAGAAGTCACTTGAGGCTAGG + Intergenic
948453731 2:238094462-238094484 TTGGGAAGCCGCTGGGTGCCTGG - Exonic
948468186 2:238162094-238162116 CTGGGCAGAAACTTGGTGCTTGG + Intronic
1169918360 20:10706389-10706411 ATGGGATGCCACTCTGTGCTAGG + Intergenic
1172307057 20:33888322-33888344 CTGGGAAACCACCAGGAGCTAGG - Intergenic
1172766155 20:37352068-37352090 CTTTGAAGCCAGTTGGTTCTGGG + Intronic
1173071795 20:39775278-39775300 CTGGAAATCCACTTGGGGATGGG + Intergenic
1173431968 20:42996142-42996164 CTGGAAGCACACTTGGTGCTGGG - Intronic
1174299891 20:49573939-49573961 CTGGGAAACCTCTCGGTCCTGGG + Intergenic
1174543670 20:51308848-51308870 CTGGGGAGCTGCCTGGTGCTTGG + Intergenic
1175780524 20:61679550-61679572 CCAGGAAGCCACTAGCTGCTGGG + Intronic
1176096983 20:63348835-63348857 CAGGGAAGCTACCTGGTGCTGGG + Intronic
1176457912 21:6929164-6929186 CTGGGAAGGCTCAGGGTGCTGGG - Intergenic
1176615977 21:9028629-9028651 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1176709176 21:10135099-10135121 CTAGGAATCCACTTGGGGCCTGG - Intergenic
1176836084 21:13794248-13794270 CTGGGAAGGCTCAGGGTGCTGGG - Intergenic
1177771634 21:25523135-25523157 CAGGGAAGCCACTGGGTCCAGGG - Intergenic
1178017243 21:28362378-28362400 CAGTGAAGCCATCTGGTGCTGGG + Intergenic
1178793794 21:35724327-35724349 GTGGGAAGCAGCTTTGTGCTGGG - Intronic
1179996790 21:44977894-44977916 CTGGGAAGGCTCAGGGTGCTGGG - Intergenic
1181608582 22:23996940-23996962 CAGGGAAGCCATCTGGTCCTGGG + Intergenic
1181809098 22:25392625-25392647 CTGGCATGCCTCTGGGTGCTAGG - Intronic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1182243590 22:28936584-28936606 CTGAGTAGCTACTTGGTGGTGGG + Intronic
1182790800 22:32951264-32951286 CAGGGAAGCCCTTTGGTGGTGGG - Intronic
1183235501 22:36613989-36614011 CAGGGGAGCCACTTGGGGGTTGG - Intronic
1184451343 22:44584502-44584524 GTGGGCTGCCACTTGGTGCCAGG - Intergenic
1184893842 22:47395678-47395700 CTGGGAACTCACTTGGGGCCTGG - Intergenic
950019875 3:9779763-9779785 CTGTGAATCCACTTTGAGCTGGG + Intronic
950995477 3:17491906-17491928 CTGGAAATCCACCTGGTCCTGGG + Intronic
951318047 3:21210546-21210568 CAGTGAAGCCATTTGGTACTGGG + Intergenic
951671104 3:25182945-25182967 CTGGCAAGCCACCAGGAGCTAGG + Intronic
952639971 3:35581634-35581656 CAGTGAAGCCACTGGGTACTGGG - Intergenic
953027876 3:39154994-39155016 CTGGGAAGCCACTGGAAGCTTGG - Intergenic
953205673 3:40826564-40826586 CTGGGTAGCCAGTGGCTGCTGGG + Intergenic
954152295 3:48663546-48663568 CTGGGATGCCACGTGGAGCCCGG + Intergenic
955096596 3:55804822-55804844 CAGGGAATCCACTTCCTGCTTGG + Intronic
955872329 3:63452189-63452211 CTGAGCAGCCACTGGGTGCCGGG + Intronic
957010932 3:75005493-75005515 CTGTGAATCCACCTGGTCCTGGG + Intergenic
957442242 3:80264514-80264536 CTGTGAATCCATTTGGTCCTGGG + Intergenic
960401996 3:117211439-117211461 CAGTGAAGCCATCTGGTGCTGGG - Intergenic
961134939 3:124501675-124501697 CTGGGAGGCCACTAGATGCAAGG + Intronic
961482139 3:127189470-127189492 CTGGGAAGCTTCTGGGGGCTAGG - Intergenic
962124209 3:132598421-132598443 CTGAGAAGCTACTTTGTGCCAGG + Intronic
962468361 3:135681712-135681734 CTGTGAAGCCATTGGGTCCTGGG - Intergenic
964027061 3:152087318-152087340 CTGGCAAGCCACTTTCTGGTTGG + Intergenic
965229002 3:166027506-166027528 CTGGGAAGACACTTGGGGTGGGG - Intergenic
966153014 3:176885846-176885868 CAGGGAAGCCATTAGGTCCTGGG - Intergenic
966644214 3:182225088-182225110 CTGTGAATCCACCTGGTTCTGGG + Intergenic
966684536 3:182679511-182679533 CTGGGAGGCTGATTGGTGCTGGG - Intergenic
966729732 3:183140704-183140726 CTGGGGAGTTACTTGGTACTGGG + Intronic
967419257 3:189255634-189255656 CTGTGAAGCCATCTGGTCCTGGG + Intronic
968063823 3:195747264-195747286 CTGGGCGGCCTCTTGCTGCTGGG - Exonic
968696143 4:2029122-2029144 CTGTGAATCCACCTGGTCCTGGG + Intronic
969232849 4:5843497-5843519 CTGGGAAGAAACGTGGTGTTTGG + Intronic
969325740 4:6442853-6442875 CTGTGCAGCCACTAGCTGCTCGG - Intronic
969496402 4:7528889-7528911 CTGGGCAGCCACCGGATGCTGGG - Intronic
971153210 4:24055833-24055855 CTGAGATGCGACTTGGTGCCAGG - Intergenic
971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG + Intronic
973555731 4:52080802-52080824 CTGGGCACCCACTTCATGCTGGG - Intronic
973929435 4:55775709-55775731 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
974493359 4:62595467-62595489 CTGGGAAGACACCTGTTGCCAGG + Intergenic
974909943 4:68105132-68105154 CTGTGAAGCCATCTGGTCCTGGG + Intronic
976943462 4:90735431-90735453 CAGTGAAGCCACTGGGTCCTGGG + Intronic
977632611 4:99260085-99260107 CTGTGAATCCATTTGGTCCTGGG + Intergenic
977994773 4:103488286-103488308 CTGTGAATCCACCTGGTCCTGGG - Intergenic
978116975 4:105031186-105031208 CTGTGAATCCACGTGGTCCTCGG - Intergenic
978829089 4:113061182-113061204 CATGGAAGCCACTTGGGGCAGGG - Intronic
979403975 4:120286143-120286165 TAGGGAAGCCACATGGTGATGGG + Intergenic
979600126 4:122578410-122578432 CAAGGAAGGCACTTTGTGCTCGG + Intergenic
980787066 4:137569679-137569701 CTGTGAATCCACCTGGTCCTGGG + Intergenic
981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG + Intronic
981073114 4:140565910-140565932 CTGGGATGTCACTAGGTGATAGG - Intronic
981133598 4:141186142-141186164 CTGGGAATCCATCTGGTCCTGGG + Intronic
981697471 4:147573452-147573474 ATGGGGGGCCACTTTGTGCTAGG + Intergenic
982789086 4:159569934-159569956 CTGTGAATCCATTTGGTCCTGGG + Intergenic
982810189 4:159815998-159816020 CTGTGAATCCATCTGGTGCTGGG - Intergenic
983011267 4:162550576-162550598 CTGGGAAGACACCCGTTGCTAGG + Intergenic
985690226 5:1305099-1305121 CAGGGAAGCCATTGGGTCCTGGG + Intergenic
986336511 5:6759513-6759535 CTGGGAAGCCACGTGGCTGTGGG + Intergenic
988642285 5:33053739-33053761 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
989832198 5:45933708-45933730 CTGAGAAACCACTTTGTGATTGG + Intergenic
990144626 5:52745117-52745139 CTGGCAAGCCACTAGATGCTAGG - Intergenic
990195258 5:53307737-53307759 CTGTGAATCCACCTGGTCCTGGG + Intergenic
990840217 5:60070790-60070812 CAGTGAAGCCACCTGGTACTGGG + Intronic
991627053 5:68614092-68614114 CAGTGAAGCCATCTGGTGCTGGG - Intergenic
992639336 5:78755260-78755282 AGGAGAAGCCACTTGGTGTTGGG - Intronic
993110154 5:83646761-83646783 CTGGGAACCCAGTGAGTGCTGGG + Intronic
993217385 5:85043866-85043888 CTGTGAATCCATTTGGTCCTGGG + Intergenic
993404255 5:87491586-87491608 CTGTGGAGCCACCTGGTCCTGGG + Intergenic
997280483 5:132640931-132640953 TGGGGAAGCCAGTTGGTGCCAGG + Intronic
997298613 5:132785722-132785744 CTGGCCAGCCCCTTGGTTCTAGG - Intronic
997876138 5:137549178-137549200 CTGTGAATCCATCTGGTGCTGGG - Intronic
998826159 5:146103518-146103540 CTGGGAAAACCCTTGGTCCTGGG - Intronic
998990246 5:147807514-147807536 CTAGGCAGCTACTTGGTGTTAGG - Intergenic
1001190360 5:169624779-169624801 CTGGGAATCCATCTGGTCCTGGG + Intergenic
1004068087 6:12269917-12269939 CAGTGAAGCCACTTGGTCCGGGG + Intergenic
1004320775 6:14629990-14630012 CTGGGAAGCCACAGTGTCCTGGG + Intergenic
1005919355 6:30385696-30385718 CTGGGAACCCATCTGGTCCTAGG - Intergenic
1006252831 6:32804264-32804286 CTGTGAATCCATTTGGTCCTGGG + Intergenic
1006807783 6:36799702-36799724 CAGGCAAGCTGCTTGGTGCTGGG - Intronic
1008424896 6:51345888-51345910 CTGTGAATCCATTTGGTCCTAGG + Intergenic
1008715064 6:54279092-54279114 CGTTGAAGCCACTTGGTTCTAGG - Intergenic
1009259206 6:61462543-61462565 CTGAGAAACCACTTTGTGATGGG + Intergenic
1009261787 6:61499982-61500004 CTGAGAAACCACTTGGTGATAGG - Intergenic
1010007120 6:71007964-71007986 CTGTGAAGCCATTTGGTCTTAGG + Intergenic
1012158630 6:95854103-95854125 TTGGGAAGCCATTTGGTCCTAGG + Intergenic
1012250989 6:96980771-96980793 CTGTGAATCCATTTGGTCCTGGG + Intronic
1012630192 6:101456390-101456412 CTAGGAAGCTACTTGGAGGTAGG + Intronic
1014179782 6:118372146-118372168 ATGGGAAGCCACTTAGTGAGAGG - Intergenic
1014418419 6:121212253-121212275 CTGTGAATCCACCTGGTCCTGGG - Intronic
1014422659 6:121264445-121264467 CTGTGAATCCATTTGGTCCTTGG - Intronic
1015529539 6:134207612-134207634 CTGGGAAGCCTTTTAGTCCTGGG + Intronic
1015554946 6:134451685-134451707 CTGCCCAGCCACTTGGTGCATGG + Intergenic
1016272390 6:142303046-142303068 CTGGAAAGCCAGACGGTGCTTGG - Intronic
1017141499 6:151194421-151194443 CTGTGAAGCCATCTGGTCCTAGG - Intergenic
1019031299 6:169015282-169015304 CTGTGAATCCACCTGGTCCTGGG + Intergenic
1019364045 7:622249-622271 CTTGGCAGGCACCTGGTGCTCGG - Intronic
1019774017 7:2901659-2901681 CTGGGGAGACGCTTGGTGCTGGG - Intergenic
1020186592 7:5963414-5963436 CCGGGAAGCCACCTGCAGCTGGG - Intronic
1020296324 7:6761360-6761382 CCGGGAAGCCACCTGCAGCTGGG + Intronic
1021208189 7:17810498-17810520 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1021347353 7:19544873-19544895 CTGTGAATCCATTTGGTCCTGGG + Intergenic
1021385698 7:20027317-20027339 CAGGGAAGCCATTTGGTTTTTGG + Intergenic
1022058513 7:26767079-26767101 CTGTGAATCCATTTGGTCCTGGG + Intronic
1023091823 7:36624806-36624828 TTGGGAGGCCACTTGCTGCGGGG - Intronic
1023771997 7:43566337-43566359 CTGGGATGACACTGGGTGTTAGG - Intergenic
1025528850 7:61850650-61850672 CTGGGAAACCACTTTGTGATGGG - Intergenic
1025550371 7:62239270-62239292 CTGAGAAACCACTTTGTGATTGG + Intergenic
1025579803 7:62697848-62697870 CTGAGAAACCGCTTGGTGATAGG - Intergenic
1025588549 7:62825053-62825075 CTGAGAAACCACTTTGTGATAGG + Intergenic
1029747840 7:102526361-102526383 CAAGGAAGCCACCTGGGGCTGGG - Intergenic
1029765790 7:102625451-102625473 CAAGGAAGCCACCTGGGGCTGGG - Intronic
1029855172 7:103508064-103508086 CTGTGAATCCACCTGGTCCTGGG - Intronic
1029955891 7:104639185-104639207 CTGTGAATCCACCTGGTCCTGGG + Intronic
1030158932 7:106487298-106487320 CTGGGATGCTACTTGATGCGTGG + Intergenic
1031971834 7:128070233-128070255 CTAGGAAGACACATGGTTCTGGG - Intronic
1033639994 7:143253527-143253549 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1033648196 7:143321089-143321111 CCAGGAAGCCCCTTGGTTCTGGG + Intronic
1034450267 7:151133480-151133502 ATGGGGGGCCACTTTGTGCTTGG - Intronic
1035374488 7:158398414-158398436 GTGGGAAGCCAGGTGGGGCTCGG + Intronic
1035702651 8:1648522-1648544 CTGGGAAGCCTCCTGGTCATAGG + Intronic
1035773482 8:2169105-2169127 CTGGAAAGCCAATTCATGCTCGG - Intergenic
1035894128 8:3378279-3378301 CTGTGAATCCACCTGGTCCTGGG - Intronic
1036394272 8:8354301-8354323 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1036850091 8:12194752-12194774 CTGGGAGGCCGGTTGGGGCTGGG + Intergenic
1036871455 8:12437025-12437047 CTGGGAGGCCGGTTGGGGCTGGG + Intergenic
1037303173 8:17475164-17475186 CAGTGAAGCCACCTGGTCCTAGG + Intergenic
1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG + Intergenic
1038707933 8:29912893-29912915 CTGTGAATCCATTTGGTCCTGGG - Intergenic
1039505920 8:38052212-38052234 CTGCAGAGCTACTTGGTGCTGGG - Intronic
1040344526 8:46476733-46476755 CTGTGAAACCACTTTGTGGTGGG - Intergenic
1041160068 8:55031830-55031852 CAGGGAAGCCATCTGGTCCTGGG - Intergenic
1041743409 8:61180369-61180391 CTGTGAATCCACCTGGTCCTGGG - Intronic
1042162747 8:65913155-65913177 GTGGTGAGCCACTTGGAGCTGGG - Intergenic
1042536527 8:69864352-69864374 CTGTGAATCCATTTGGTCCTGGG - Intergenic
1043235612 8:77862039-77862061 CAGTGAAGCCACTGGGTCCTGGG - Intergenic
1044135587 8:88581695-88581717 CTGTGAATCCATTTGGTCCTGGG + Intergenic
1045540618 8:103080914-103080936 ATGGGAGCCCACTGGGTGCTGGG + Intergenic
1046931139 8:119842995-119843017 CTGGGAAGCTACTATGTGCCAGG + Intronic
1047551733 8:125881055-125881077 TTGTGAAGCCACCTGGTTCTTGG + Intergenic
1048530311 8:135242216-135242238 CTGTCAAGCCACTTGGATCTGGG - Intergenic
1048824908 8:138414931-138414953 ATAGGAAACCATTTGGTGCTTGG - Intronic
1049115501 8:140683382-140683404 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1049128488 8:140814184-140814206 CTGTGAATCCATGTGGTGCTGGG - Intronic
1049738830 8:144224795-144224817 CTGTGGTGCCACTGGGTGCTGGG + Intronic
1049892747 9:85746-85768 CTGGGAAGCCATCTGGTTTTGGG - Intergenic
1050505466 9:6343899-6343921 CAGTGAAGCCACTGGGTCCTGGG - Intergenic
1051024470 9:12590402-12590424 CTGGGAAGCAAATTTGTCCTTGG - Intergenic
1051324793 9:15953785-15953807 CAGTGAAGCCATTTGGTCCTAGG + Intronic
1051441918 9:17093830-17093852 CTGTGAAGTGACTTGGTGCTGGG - Intergenic
1051846824 9:21460765-21460787 CAGTGAAGCCATTTGGTCCTGGG + Intergenic
1053108038 9:35430194-35430216 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
1053312083 9:37026616-37026638 CTGGGCAGCCCCTTGGCGCCGGG - Intronic
1053646147 9:40120627-40120649 CTAGGAATCCACTTGGGGCCTGG - Intergenic
1053759568 9:41342913-41342935 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1054327160 9:63718524-63718546 CTAGGAATCCACTTGGGGCCTGG - Intergenic
1054362615 9:64191435-64191457 CTGAGAAACCACTTTGTGATGGG + Intergenic
1054538423 9:66255349-66255371 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1054694431 9:68345747-68345769 CTGGGAAGCCATCTGGTTTTGGG + Intronic
1055378260 9:75675021-75675043 CTGTGAAGCCATCGGGTGCTGGG + Intergenic
1056130248 9:83578209-83578231 CTGTGAAGCCATTTGGTCCTGGG - Intergenic
1057021746 9:91704330-91704352 CTGTGAAACCATTTGGTCCTAGG + Intronic
1057697297 9:97333475-97333497 CTGTGAATCCATTTGGTCCTGGG + Intronic
1057932547 9:99207616-99207638 CAGTGAAGCCACTTGGTCCTGGG + Intergenic
1058184375 9:101837313-101837335 CTGTGAATCCACCTGGTCCTGGG - Intergenic
1058207095 9:102121957-102121979 CTGGAAAGCCCCTTGGTTCCAGG + Intergenic
1058405130 9:104664375-104664397 CTGTGAATCCATCTGGTGCTGGG - Intergenic
1058526243 9:105861550-105861572 CTGTGAATCCATTTGGTCCTGGG - Intergenic
1058898119 9:109417641-109417663 GTGGGAAGCCACTTTGTGCTGGG - Intronic
1059087048 9:111315548-111315570 TAGTGAAGCCACTTGGTCCTGGG - Intergenic
1060073234 9:120569236-120569258 CTGAGAATCCACTTTCTGCTAGG + Intronic
1060751692 9:126173879-126173901 CTGAGAAGCAAGTTTGTGCTTGG - Intergenic
1060803726 9:126562009-126562031 CTGGGAAGTCCCTTAGTTCTGGG + Intergenic
1061415164 9:130443702-130443724 CTGGTGAGCCACGTGGGGCTGGG - Intergenic
1061433826 9:130548042-130548064 CTGGGAACCCACTTGGACCAAGG - Intergenic
1062003519 9:134228387-134228409 TTGGGATGCCACTGGGTCCTGGG + Intergenic
1062330290 9:136039379-136039401 CAGCGAAGCCACTTGGGCCTGGG - Intronic
1062518881 9:136949532-136949554 CTGGGAGGCCCCTTGGGGGTGGG - Intronic
1062600914 9:137318270-137318292 CTGGGAAGCCCTGTGGGGCTGGG - Intronic
1185769139 X:2751944-2751966 CTGAGATGCCCATTGGTGCTTGG + Intergenic
1186196988 X:7118854-7118876 CTGGGTACCTACTTTGTGCTAGG + Intronic
1186264456 X:7817189-7817211 CTGGGGTGCCACCTGGTGTTTGG + Intergenic
1186431264 X:9506814-9506836 CTGTGAATCCATTTGGTCCTGGG - Intronic
1187238595 X:17491731-17491753 CTGTGAATCCACCTGGTCCTGGG + Intronic
1187277866 X:17832228-17832250 CTGGGAAGCCCCTCAGTCCTGGG - Intronic
1187496320 X:19798848-19798870 ATGTGAAGGCACCTGGTGCTTGG - Intronic
1188456523 X:30372815-30372837 CTGGGAAATCCCTTGGTCCTAGG - Intergenic
1188931064 X:36111719-36111741 CTGTGAATCCATTTGGTCCTGGG + Intronic
1189409030 X:40753682-40753704 CTGTGAAGCCATCTGGTCCTGGG + Intergenic
1189574691 X:42339061-42339083 CTGTGAATCCATCTGGTGCTGGG + Intergenic
1189867599 X:45347290-45347312 CTGGGAAGCCATTTGAATCTTGG + Intergenic
1190071414 X:47282979-47283001 CTGGAAACCCACTGGGAGCTTGG - Intergenic
1190379532 X:49826782-49826804 CTGGGAAGGCTCATGGTGCTGGG + Intergenic
1190615020 X:52221627-52221649 CAGGGAAGCCATTGGGTCCTGGG - Intergenic
1191253332 X:58269500-58269522 CCGGGAAGGCACTGGGTTCTTGG + Intergenic
1192063911 X:67861028-67861050 CTGGGAATCCATCTGGTCCTGGG + Intergenic
1192332399 X:70186877-70186899 CTAGGAAGACACGTGGGGCTAGG + Intronic
1192362111 X:70446611-70446633 CTTGGGAGCCCCTGGGTGCTGGG + Intronic
1192741382 X:73896333-73896355 CTGGGAATCCATCTGGTCCTAGG - Intergenic
1192899146 X:75476319-75476341 CTGTGAAGCCATCTGGTCCTTGG + Intronic
1192992428 X:76474702-76474724 CTGGGAATCCATCTGGTCCTGGG - Intergenic
1194102446 X:89723001-89723023 CAGTGAAGCCACATGGTCCTGGG + Intergenic
1194325201 X:92506823-92506845 CTGTGAATCCACCTGGTCCTGGG + Intronic
1194510829 X:94792361-94792383 CTGTGAATCCACATGGTACTGGG - Intergenic
1194540218 X:95160719-95160741 CTGGGAATCCATCTGGTCCTGGG - Intergenic
1194632642 X:96304261-96304283 CAGGGAAGCCACCAGGTTCTGGG + Intergenic
1194989590 X:100532372-100532394 CAGTGAAGCCACCTGGTTCTGGG + Intergenic
1195116128 X:101699990-101700012 CTGTGAAGCCACTGGGTCCTGGG - Intergenic
1195784758 X:108507074-108507096 CTGTGAATCCACCTGGTCCTGGG - Intronic
1195913205 X:109910269-109910291 CTGGGAAACCTCTCGGTCCTGGG - Intergenic
1196470721 X:116022490-116022512 CAGGGAAGCCATCTGGTCCTAGG - Intergenic
1196494063 X:116303220-116303242 CAGTGAAGCCATTTGGTCCTGGG + Intergenic
1196614079 X:117747654-117747676 CAGTGAAGCCACTGGGTCCTGGG - Intergenic
1196892970 X:120308536-120308558 GTGGGCAGCCACTTGTTTCTAGG - Intronic
1197058693 X:122151472-122151494 CTGTGAAGCCATTTGTTCCTGGG - Intergenic
1197099276 X:122632971-122632993 CAGGGAAGCCACTGGGTCCTGGG + Intergenic
1197279127 X:124514732-124514754 CTGTGAATCCACCTGGTCCTGGG - Intronic
1197474483 X:126904001-126904023 CTGTGAATCCACCTGGTCCTGGG - Intergenic
1198333878 X:135648071-135648093 GTGACAAGACACTTGGTGCTTGG + Intergenic
1199247983 X:145629621-145629643 CAGTGAAGCCACTGGGTCCTGGG - Intergenic
1200010578 X:153117563-153117585 TGGTGAAGCCACTTGGTGCTGGG + Intergenic
1200029022 X:153282359-153282381 TGGTGAAGCCACTTGGTGCTGGG - Intergenic
1200455032 Y:3380278-3380300 CAGTGAAGCCACATGGTCCTGGG + Intergenic
1200633930 Y:5626016-5626038 CTGTGAATCCACCTGGTCCTGGG + Intronic
1201301367 Y:12507678-12507700 CTGAGATGCCCATTGGTGCTTGG - Intergenic
1201647348 Y:16250004-16250026 CTGCAAAGCCATTTGGTGCTGGG - Intergenic
1201655463 Y:16335297-16335319 CTGCAAAGCCATTTGGTGCTGGG + Intergenic