ID: 971257551

View in Genome Browser
Species Human (GRCh38)
Location 4:25029119-25029141
Sequence CAACCAGGAGGCAAGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971257547_971257551 -2 Left 971257547 4:25029098-25029120 CCATCTGCCAGATAAAACGGTCA 0: 1
1: 0
2: 0
3: 5
4: 67
Right 971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 167
971257541_971257551 29 Left 971257541 4:25029067-25029089 CCTGAACTCCCCTGTGTGGGGAG 0: 1
1: 0
2: 1
3: 12
4: 281
Right 971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 167
971257543_971257551 21 Left 971257543 4:25029075-25029097 CCCCTGTGTGGGGAGAGGCAGTA 0: 1
1: 0
2: 2
3: 29
4: 202
Right 971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 167
971257549_971257551 -9 Left 971257549 4:25029105-25029127 CCAGATAAAACGGTCAACCAGGA 0: 1
1: 0
2: 1
3: 1
4: 38
Right 971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 167
971257545_971257551 19 Left 971257545 4:25029077-25029099 CCTGTGTGGGGAGAGGCAGTACC 0: 1
1: 0
2: 0
3: 25
4: 174
Right 971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 167
971257544_971257551 20 Left 971257544 4:25029076-25029098 CCCTGTGTGGGGAGAGGCAGTAC 0: 1
1: 0
2: 1
3: 22
4: 191
Right 971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971257551 Original CRISPR CAACCAGGAGGCAAGATGCT TGG Intronic
902890477 1:19439690-19439712 CAGCCGGGAGGGAAGCTGCTTGG - Intronic
903213750 1:21832056-21832078 GAACAAGGAGGCCAGGTGCTAGG - Intronic
904058317 1:27686717-27686739 CAACAAAAAGGCAAGATGCCGGG + Intergenic
904269655 1:29341557-29341579 CAGCAAGGAGGCCAGATGCCAGG - Intergenic
904372250 1:30057191-30057213 CTGGCAGGAGGCAAAATGCTGGG - Intergenic
906043691 1:42810577-42810599 GATCAAGGAGGCAAGATGGTAGG + Intronic
908669967 1:66534957-66534979 GAATCAGGAGGCAAGAGGCCCGG - Intronic
909125646 1:71665469-71665491 CAAACAGGAGGATAGATGCAAGG + Intronic
919257849 1:195148366-195148388 CAGCCAAGAGTCAAGATGCAAGG + Intergenic
919737571 1:200962692-200962714 CAAGCAGGAAGCAGGAGGCTGGG + Intergenic
919880102 1:201895478-201895500 GGACCAGGAGGCAAGAAGCTTGG + Intergenic
920164454 1:204025914-204025936 CAGGCAGCAGGCAAGGTGCTGGG - Intergenic
1063954931 10:11256905-11256927 CCACCGGGAGGCAAGATTCTCGG - Intronic
1064284549 10:13981367-13981389 CGACCAGGAGGCCAGAAACTAGG + Intronic
1066109262 10:32181888-32181910 AAATCAGGAGACAAGGTGCTGGG - Intergenic
1066695583 10:38074843-38074865 TATCCTGGAGGCAAGATGCTGGG + Intergenic
1066996949 10:42572715-42572737 TACCCTGGAGGCAAGATGCTGGG - Intergenic
1067089058 10:43257438-43257460 CGCCCAGGAGGCAGGATTCTGGG + Intronic
1070753866 10:78979633-78979655 CCACCAGGAAGCAAGAAGCACGG + Intergenic
1073849681 10:107600271-107600293 CAACGAAGAGGGAAGAAGCTAGG + Intergenic
1073946394 10:108755577-108755599 AAACCAGGAAGTAAAATGCTTGG + Intergenic
1074142463 10:110686022-110686044 CAATGTGGATGCAAGATGCTGGG - Intronic
1074242955 10:111657238-111657260 CAAGCATGAGGCTAGTTGCTGGG - Intergenic
1074878217 10:117631257-117631279 CAAACACGAGGCAAGTTTCTAGG + Intergenic
1076462968 10:130658983-130659005 AGACCTGGAGGCAACATGCTTGG + Intergenic
1078272745 11:9811756-9811778 GAAACAAGAGGCAGGATGCTTGG + Intronic
1078976456 11:16483995-16484017 CCTCCAGGAGGCAAGGTCCTCGG + Intronic
1079214288 11:18493547-18493569 CATCCAGGAGTAAAAATGCTGGG - Intronic
1080755775 11:35196782-35196804 CAACCAAGAGGCAAGAAACCTGG + Exonic
1084681792 11:70670628-70670650 CGACCAGGAAGCAGGATGCTGGG - Intronic
1084938423 11:72599622-72599644 CAGCTAGGAGGCTAGAGGCTTGG - Intronic
1085700125 11:78738450-78738472 CAATCAGCAGGCAAGATGGCAGG - Exonic
1086071817 11:82807903-82807925 CAAGAAGGAGGCTAGAAGCTAGG + Intergenic
1087231754 11:95674067-95674089 CAGCCACCAGGCTAGATGCTGGG - Intergenic
1092128008 12:6088784-6088806 CAAACTGAAGGCAAGATGGTTGG - Intronic
1092237530 12:6819418-6819440 CGAACAGGAGGCCAGAGGCTGGG - Exonic
1096100315 12:48966937-48966959 CAACGATGAGGCACTATGCTGGG + Intronic
1096496600 12:52042607-52042629 CACCCAGGAGGCATGGTTCTGGG - Intronic
1097041797 12:56160421-56160443 GAGCCAGGAGGCAAGGTGCAGGG + Intronic
1099005148 12:77226806-77226828 CCACAAGGAGGCAAGACGGTAGG - Intergenic
1100777122 12:97987623-97987645 CATGCACGATGCAAGATGCTGGG + Intergenic
1101125230 12:101626892-101626914 CAACCTGGAGGCAAGGCGCTAGG - Intronic
1102566753 12:113802139-113802161 CAACCAGGCGGCCTGATTCTGGG - Intergenic
1102772001 12:115486133-115486155 GCACCATCAGGCAAGATGCTTGG - Intergenic
1109434345 13:62279677-62279699 CAAACATGAGGCACCATGCTTGG - Intergenic
1112414732 13:99194874-99194896 CAGGCAGGAGGGAAGATGGTTGG - Intergenic
1112616570 13:101013087-101013109 CAACTAGGTGGCAGGAAGCTAGG + Intergenic
1113443542 13:110347907-110347929 TAACCAGGAGGCATGACGTTCGG - Intronic
1114985370 14:28220545-28220567 GAACCAGGAGGACAGATGGTAGG - Intergenic
1117463397 14:55968950-55968972 AAACCGGAAGGCAAGATCCTGGG - Intergenic
1118355396 14:65009431-65009453 GAACTAGGAGTCAAGATGGTGGG - Intronic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1120205674 14:81584720-81584742 TAACCAGGAGGCAAGCAGCACGG + Intergenic
1121805189 14:96812889-96812911 AAACCAGTAGGTAAAATGCTTGG + Intronic
1128155814 15:65391248-65391270 CAACCAGAAGCCATGAAGCTTGG - Intronic
1130896528 15:88174431-88174453 AGGCCAGGAGGGAAGATGCTGGG - Intronic
1136498067 16:30655930-30655952 CAACCAGGAGGTGAGACACTTGG + Exonic
1138451988 16:57098500-57098522 GAACCAGGATGCAGGATGTTGGG + Intronic
1139287684 16:65830136-65830158 CAACCAGGAGGAAAGCACCTGGG + Intergenic
1141859879 16:86709308-86709330 CAACAATGAGGCAAGATCCCTGG + Intergenic
1142216795 16:88834024-88834046 CTCCCAGGAGGCAGGGTGCTGGG - Intronic
1145029393 17:19493157-19493179 CACCTAGGAGGGAAGAGGCTGGG + Intergenic
1147480085 17:40752480-40752502 CAACCAGGAGGAAAGAAGGCTGG - Intronic
1149204834 17:54231863-54231885 CATCAAAGAGGCAAGATTCTAGG - Intergenic
1149949196 17:60966948-60966970 TAACCAAAAGTCAAGATGCTGGG - Intronic
1151685315 17:75642920-75642942 CAACCAGGAGGCCAAGTTCTGGG - Intronic
1151842764 17:76629408-76629430 CACCCAGAGGGCAAGATGCAGGG - Exonic
1152164407 17:78692948-78692970 GAAGCAGGAGGGGAGATGCTGGG + Intronic
1155249887 18:23944331-23944353 TAAGCAAGAGCCAAGATGCTAGG - Intronic
1156615803 18:38783126-38783148 GAAGCAGGGGGCAAGCTGCTGGG + Intergenic
1158185336 18:54765036-54765058 CAGGCAGGTTGCAAGATGCTAGG + Intronic
1160307865 18:77757819-77757841 TAACAAGCAGGCATGATGCTAGG + Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163177851 19:15577014-15577036 CAAACAGGAGGCAAGAGACTGGG + Intergenic
1164391295 19:27823328-27823350 CAAGAAGGAGGAAAGATGCAAGG + Intergenic
926261137 2:11263168-11263190 CAACCAGGAGGCAAGGATGTTGG - Intronic
927025846 2:19068390-19068412 CATCCAGGAGCCAAGAAGCATGG - Intergenic
927212916 2:20649736-20649758 CACCCTGCAGGCAAGATCCTTGG + Intronic
927996337 2:27489444-27489466 CGTCCAGGAGGCGAGATGCAGGG - Intronic
928506681 2:31961059-31961081 CAAAAAGGAGGCAAGAGGCCAGG + Intronic
931617406 2:64174008-64174030 AAACCAGGAGGCCAGAATCTGGG + Intergenic
931730364 2:65147852-65147874 CACCCAGAAGGCTGGATGCTTGG + Intergenic
933895270 2:86805579-86805601 CAAACATGGGGCCAGATGCTCGG - Intronic
935052111 2:99532675-99532697 CAGCCAGGAGCCACCATGCTTGG + Intergenic
936916642 2:117646178-117646200 CATCAAGGAAGAAAGATGCTGGG + Intergenic
938776449 2:134545449-134545471 CCACCAGGAAGAAAGAGGCTTGG - Intronic
942091961 2:172500667-172500689 AAACCAGGAGCCAAGAGGCCTGG - Intronic
944310948 2:198233275-198233297 TAACCAGGAGACAAGTTGATGGG - Intronic
945485868 2:210394964-210394986 CAATCTGGAGGCAAGTAGCTGGG - Intergenic
945997752 2:216453061-216453083 CACCCAGTAGGCAGGATTCTGGG - Intronic
946461422 2:219872238-219872260 CAACTGGGAGGCAAGATGTGTGG - Intergenic
948033682 2:234840522-234840544 CAAGAAGGAGGCCAGATGCAAGG - Intergenic
1172444044 20:34984029-34984051 CGTCCAGGCGGCAGGATGCTGGG + Intronic
1173289074 20:41698636-41698658 AAACCAGGAGGCAGGATCATTGG - Intergenic
1175710419 20:61216286-61216308 CCACAAAGGGGCAAGATGCTGGG - Intergenic
1175862015 20:62155625-62155647 CAGCCTGGAGGAAAGATGCTTGG - Intronic
1179422914 21:41250284-41250306 GCACCAGGAGGCAACTTGCTGGG + Intronic
1179574547 21:42299670-42299692 CAGCCACGAGGAAAGGTGCTCGG - Intergenic
1181774470 22:25149530-25149552 AAGGGAGGAGGCAAGATGCTTGG - Intronic
1181882372 22:25991268-25991290 TTACCAGGAGGTTAGATGCTGGG + Intronic
1182212618 22:28689529-28689551 CAATCAGGAGGCCAGAGGCTGGG + Intronic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
1182282000 22:29223204-29223226 CAGCCAGGAGGCCAGATGACAGG + Intronic
1184410211 22:44321957-44321979 CAGACAGGAGGCAGGAGGCTGGG + Intergenic
1184986690 22:48140727-48140749 CACACAGCAGGTAAGATGCTTGG - Intergenic
949322114 3:2823203-2823225 AAACCAGGAGACCATATGCTGGG - Intronic
949888604 3:8715228-8715250 CAGCCAGGAGGAAAGTTGCTTGG - Intronic
953958990 3:47252735-47252757 CAAGCATGAGCCAACATGCTTGG - Intronic
955362360 3:58286431-58286453 CAAGCATGAGCCAACATGCTTGG + Intronic
955663484 3:61326124-61326146 CAGCCTGGAGGTAAAATGCTGGG - Intergenic
955810383 3:62781741-62781763 CAAGCAGACGGCAAGATGGTAGG + Intronic
959163962 3:102753650-102753672 AATCCAGGAGGGAAGAAGCTTGG - Intergenic
959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG + Intergenic
962203892 3:133419673-133419695 TAACCAGGACGCATGAGGCTGGG + Intronic
964429440 3:156589368-156589390 CAACCAGATGGTAAGATGCTAGG + Intergenic
969282359 4:6179301-6179323 CAACCACCATGCAAGATGGTAGG - Intronic
969665645 4:8555861-8555883 CACCCAGGACGGAAGCTGCTGGG + Intergenic
969959122 4:10925260-10925282 CAACCAGAAGGCAACGTGGTAGG - Intergenic
970794218 4:19892345-19892367 CAACCCCGGGGCCAGATGCTAGG + Intergenic
971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG + Intronic
974557184 4:63465921-63465943 GCAGCAGGAGGCAAAATGCTAGG + Intergenic
977617687 4:99104494-99104516 CAACCAGGATACCAGATACTGGG + Intergenic
982321461 4:154081701-154081723 CAACCAGCAGGAGAGATGTTTGG + Intergenic
983689833 4:170454887-170454909 AAACCATGAGGAAAGATGATCGG - Intergenic
983701442 4:170600112-170600134 TAGCCAGGAGGCAAGATGTAAGG - Intergenic
983882323 4:172947288-172947310 CAAGCTGGGGGCAAGATGCCAGG + Intronic
986182752 5:5408904-5408926 CTACCAGTAGGCAAGTTCCTGGG + Intergenic
989140811 5:38199516-38199538 CTACCAAGAGGCAAAAAGCTAGG + Intergenic
992000296 5:72429865-72429887 CAACCAGGATTCAAGTTACTGGG - Intergenic
992687110 5:79209773-79209795 CCAACAGGAGACAAGATACTGGG - Intronic
993116059 5:83721797-83721819 TAACCAGTGGGGAAGATGCTGGG + Intergenic
993580984 5:89660901-89660923 CAACCAGGATGCAAAAGCCTTGG + Intergenic
994998235 5:107092953-107092975 CATCCAGGAGGCCAGATGCCAGG - Intergenic
995544735 5:113218453-113218475 CAACCAGGAGGGCAGAAGGTGGG + Intronic
997860520 5:137411327-137411349 CAAGCAGGAGGCAAGATGGAGGG + Intronic
998864035 5:146476863-146476885 TACCCAGGAGGCAGGAGGCTGGG - Intronic
999319701 5:150606221-150606243 CAAGCTGGAGGACAGATGCTGGG + Intronic
999411617 5:151354910-151354932 AAAAAAGGAGGCTAGATGCTGGG + Intergenic
1002795110 6:465690-465712 CATCCAGGAGCCAGAATGCTGGG + Intergenic
1011127005 6:84018807-84018829 CAAGCAGCAGGCACCATGCTGGG - Intergenic
1011238531 6:85245046-85245068 CAACCAGGAGTGAAGAGGCAAGG + Intergenic
1011264012 6:85497036-85497058 CAACCAGGAGGCCAGGGGCGGGG - Intergenic
1012585477 6:100916324-100916346 CAGCAAGGAGGCAGGATGGTTGG - Intergenic
1014431982 6:121381826-121381848 CACACAGGAGGGAAGATCCTGGG + Intergenic
1014781897 6:125574375-125574397 CAACCAGGAAACATAATGCTTGG + Intergenic
1017521293 6:155205568-155205590 CAACCAGGCAGCAAGAGACTAGG - Intronic
1018499362 6:164389004-164389026 CGCCAAGGAGACAAGATGCTGGG - Intergenic
1018842215 6:167525420-167525442 ATTCCAGGAGGCAAGATGTTTGG - Intergenic
1022888716 7:34674107-34674129 CAACAAGGAGGCCTGAAGCTAGG - Intronic
1023090450 7:36613302-36613324 CAACAACGAGGGAAGATACTAGG - Intronic
1023797413 7:43805235-43805257 CAATGAGGAAGCAAGATGTTGGG + Intronic
1026365376 7:69643358-69643380 CAACCAGGAGGCAAGGGTCATGG + Intronic
1034450223 7:151133284-151133306 GAAGCAGGAGGCAACAGGCTGGG + Intronic
1035729073 8:1842095-1842117 GAACCACGAGGCCAGGTGCTGGG + Intronic
1037958754 8:23080196-23080218 CAAAAATGAGGCAAGATTCTTGG - Intergenic
1041163734 8:55071463-55071485 GATCCAGGAGGTAAGAAGCTTGG + Intergenic
1043550644 8:81368392-81368414 CAAGCAGGAGCCACCATGCTTGG + Intergenic
1044818988 8:96143439-96143461 CCATCAGGAGGGAAGATGGTGGG - Exonic
1047552514 8:125890506-125890528 CAACCTGGAGGCAACATGGATGG - Intergenic
1048235288 8:132683755-132683777 GATCCAGGAGAAAAGATGCTGGG - Intergenic
1049042215 8:140121065-140121087 CAATCACTAGGCAAGATGTTGGG + Intronic
1049479690 8:142815980-142816002 CAGCCAGGAGCCAGGATGCAAGG + Intergenic
1050183085 9:2941628-2941650 CATCCAGGAGGCAATTGGCTAGG + Intergenic
1051192777 9:14532754-14532776 CAACCAGGAGGCAATGGGCCTGG + Intergenic
1051376397 9:16407024-16407046 CTGCCACGAGGCAAAATGCTTGG + Intergenic
1052946819 9:34175299-34175321 AAACCAGGAAGGAAGAGGCTTGG - Intergenic
1052991324 9:34520868-34520890 GAACAAGAAGGGAAGATGCTGGG - Exonic
1056831775 9:89923174-89923196 CAACCTGGAGTCATGAAGCTTGG + Intergenic
1057014791 9:91642227-91642249 CAACCAGGAGAGGGGATGCTGGG + Intronic
1057725829 9:97567561-97567583 CAACCAGTAGGCAACCTGCTAGG - Intronic
1059128818 9:111722553-111722575 CTTCGAGGAGGCAAAATGCTTGG + Exonic
1059776327 9:117478927-117478949 CATGCAGAAGGCAAGATGCCTGG - Intergenic
1061940622 9:133881931-133881953 CAAGCAGGAGGCGTCATGCTGGG - Intronic
1062061298 9:134496737-134496759 TAGCCAGGAGGAGAGATGCTGGG - Intergenic
1062142745 9:134968798-134968820 GCACCAGAAGGCAAGTTGCTCGG + Intergenic
1186012129 X:5146104-5146126 CCACCAGGTGCCCAGATGCTTGG + Intergenic
1189792536 X:44617819-44617841 CAACAAGGAGGCAACACGTTCGG - Intergenic
1192504011 X:71670046-71670068 CAACCTGGAGTCACAATGCTAGG + Intergenic
1192509963 X:71715839-71715861 CAACCTGGAGTCACAATGCTAGG - Intronic
1192516734 X:71765714-71765736 CAACCTGGAGTCACAATGCTAGG + Intronic
1195369153 X:104156145-104156167 CAACAGGGAGGGAAGGTGCTTGG + Intronic
1196595797 X:117544152-117544174 CAACCATGTGGAAAGATGCCTGG + Intergenic
1198555009 X:137783552-137783574 CCATCAGGAGGCAGGATTCTTGG - Intergenic
1199266553 X:145834635-145834657 CAGCCCTGGGGCAAGATGCTGGG + Intergenic